Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712354470:

Variant ID: vg0712354470 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12354470
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.03, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGGGATAACTTATGCTTCACTATTATTTAATGATGGCTTAATGGTAGCTCATGATGGTTAATCATGATTGGTTAATTAATTAATTTGCCAACTAAAAA[T/C,A]
TGATAATGGTGGGTTGTGAGCATATGATTTTGATGGTTGTGCTCATGACAATTAAGGACCGGTTCACGATTTTCGGTTGTGAAACATTTACCGTGCCAAC

Reverse complement sequence

GTTGGCACGGTAAATGTTTCACAACCGAAAATCGTGAACCGGTCCTTAATTGTCATGAGCACAACCATCAAAATCATATGCTCACAACCCACCATTATCA[A/G,T]
TTTTTAGTTGGCAAATTAATTAATTAACCAATCATGATTAACCATCATGAGCTACCATTAAGCCATCATTAAATAATAGTGAAGCATAAGTTATCCCAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.90%	6.50%	42.72%	21.86%	A: 0.04%
All Indica	2759	5.40%	10.10%	59.99%	24.43%	A: 0.07%
All Japonica	1512	74.80%	0.40%	6.02%	18.78%	NA
Aus	269	17.80%	4.80%	67.66%	9.67%	NA
Indica I	595	0.30%	15.10%	62.18%	22.35%	NA
Indica II	465	7.70%	11.20%	65.16%	15.91%	NA
Indica III	913	5.90%	6.20%	58.27%	29.46%	A: 0.11%
Indica Intermediate	786	7.10%	10.30%	57.25%	25.19%	A: 0.13%
Temperate Japonica	767	66.00%	0.30%	2.74%	31.03%	NA
Tropical Japonica	504	86.10%	0.80%	11.51%	1.59%	NA
Japonica Intermediate	241	79.30%	0.00%	4.98%	15.77%	NA
VI/Aromatic	96	2.10%	2.10%	51.04%	44.79%	NA
Intermediate	90	41.10%	5.60%	46.67%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712354470	T -> DEL	N	N	silent_mutation	Average:34.584; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0712354470	T -> A	LOC_Os07g22110.1	upstream_gene_variant ; 2645.0bp to feature; MODIFIER	silent_mutation	Average:34.584; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0712354470	T -> A	LOC_Os07g22100.1	downstream_gene_variant ; 1891.0bp to feature; MODIFIER	silent_mutation	Average:34.584; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0712354470	T -> A	LOC_Os07g22100-LOC_Os07g22110	intergenic_region ; MODIFIER	silent_mutation	Average:34.584; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0712354470	T -> C	LOC_Os07g22110.1	upstream_gene_variant ; 2645.0bp to feature; MODIFIER	silent_mutation	Average:34.584; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0712354470	T -> C	LOC_Os07g22100.1	downstream_gene_variant ; 1891.0bp to feature; MODIFIER	silent_mutation	Average:34.584; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0712354470	T -> C	LOC_Os07g22100-LOC_Os07g22110	intergenic_region ; MODIFIER	silent_mutation	Average:34.584; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712354470	NA	4.69E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712354470	NA	3.79E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712354470	NA	6.09E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712354470	NA	7.04E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712354470	4.70E-06	4.70E-06	mr1643_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712354470	NA	4.33E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712354470	NA	4.80E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251