Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712111505:

Variant ID: vg0712111505 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12111505
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTATGTCACCATTCCACTTGCTTTGGTAAGAACTTGTAAGAGCTTGGTTAAAGGATTGAGTGTGTGTGATATTTGAGCTGCCACTACCTAGTAGTTGA[T/A]
AGGAGCGTGCATATTCTTGTGTGTGTTTCTTGTTTGCTACTAACCATGGCAGGATTGCGCAAGGGAATACGAGAACATCGGCTTCTTCACCGTCTACAAG

Reverse complement sequence

CTTGTAGACGGTGAAGAAGCCGATGTTCTCGTATTCCCTTGCGCAATCCTGCCATGGTTAGTAGCAAACAAGAAACACACACAAGAATATGCACGCTCCT[A/T]
TCAACTACTAGGTAGTGGCAGCTCAAATATCACACACACTCAATCCTTTAACCAAGCTCTTACAAGTTCTTACCAAAGCAAGTGGAATGGTGACATACAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.60%	4.60%	8.80%	8.99%	NA
All Indica	2759	70.90%	3.10%	13.05%	12.94%	NA
All Japonica	1512	92.90%	3.80%	0.99%	2.25%	NA
Aus	269	61.70%	26.40%	7.43%	4.46%	NA
Indica I	595	84.00%	0.20%	7.56%	8.24%	NA
Indica II	465	77.60%	2.40%	13.76%	6.24%	NA
Indica III	913	57.70%	3.90%	16.32%	22.02%	NA
Indica Intermediate	786	72.30%	4.80%	12.98%	9.92%	NA
Temperate Japonica	767	88.80%	6.90%	1.30%	3.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	91.70%	2.10%	1.66%	4.56%	NA
VI/Aromatic	96	60.40%	2.10%	18.75%	18.75%	NA
Intermediate	90	91.10%	1.10%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712111505	T -> DEL	N	N	silent_mutation	Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0712111505	T -> A	LOC_Os07g20940.1	upstream_gene_variant ; 46.0bp to feature; MODIFIER	silent_mutation	Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0712111505	T -> A	LOC_Os07g20930.1	downstream_gene_variant ; 1441.0bp to feature; MODIFIER	silent_mutation	Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0712111505	T -> A	LOC_Os07g20930-LOC_Os07g20940	intergenic_region ; MODIFIER	silent_mutation	Average:61.726; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712111505	NA	4.14E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712111505	NA	2.99E-08	mr1167_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712111505	NA	1.79E-06	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251