Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711805867:

Variant ID: vg0711805867 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11805867
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACAGAGCAGGAATCGGTTGGAGTCCGGATCGGCTATGGTTAGGATCGGCTGAGTCTGAGTCGAGCTAAATAAGCCGATATAGCCGATTCCGACAATAC[G/A]
ACTTGTACGCGACATCGGGTTCAAGTTGATGTATTTCAAGATAATTGCCACGCATGGATAGAGTCCTAGGAAGGCAATTGTATCTATTAATTAAGATATT

Reverse complement sequence

AATATCTTAATTAATAGATACAATTGCCTTCCTAGGACTCTATCCATGCGTGGCAATTATCTTGAAATACATCAACTTGAACCCGATGTCGCGTACAAGT[C/T]
GTATTGTCGGAATCGGCTATATCGGCTTATTTAGCTCGACTCAGACTCAGCCGATCCTAACCATAGCCGATCCGGACTCCAACCGATTCCTGCTCTGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	26.50%	0.36%	8.40%	NA
All Indica	2759	96.90%	1.40%	0.00%	1.67%	NA
All Japonica	1512	6.30%	75.10%	0.73%	17.86%	NA
Aus	269	79.60%	15.60%	0.00%	4.83%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.20%	0.00%	0.11%	NA
Indica Intermediate	786	91.70%	2.50%	0.00%	5.73%	NA
Temperate Japonica	767	2.00%	66.80%	1.30%	29.99%	NA
Tropical Japonica	504	13.70%	85.70%	0.00%	0.60%	NA
Japonica Intermediate	241	5.00%	79.30%	0.41%	15.35%	NA
VI/Aromatic	96	26.00%	1.00%	6.25%	66.67%	NA
Intermediate	90	56.70%	38.90%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711805867	G -> DEL	N	N	silent_mutation	Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0711805867	G -> A	LOC_Os07g20430.1	upstream_gene_variant ; 2236.0bp to feature; MODIFIER	silent_mutation	Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0711805867	G -> A	LOC_Os07g20450.1	downstream_gene_variant ; 4191.0bp to feature; MODIFIER	silent_mutation	Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0711805867	G -> A	LOC_Os07g20440.1	intron_variant ; MODIFIER	silent_mutation	Average:42.761; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711805867	NA	6.89E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867	NA	9.81E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867	NA	2.63E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867	NA	9.76E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867	NA	9.43E-08	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711805867	3.19E-06	3.19E-06	mr1852_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251