Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710838475:

Variant ID: vg0710838475 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10838475
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:

TTATTCTAGGCACCATTTAGAGGATATATTTTAGGGTCGTTTTGGGACGTGACAATGGAGTTGCAGTTCTGATGGTTCAGTTGGTAGCTTATTTTGGGTG[G/A]
ATGGAGCCTCCAAAGAAGCCTACAAAAAATTTGGTGATTGTATCGTCTTCGACACAACATACTGCACCAATAGGTATAACCTTCCTTTTGCTCCAATCAT

Reverse complement sequence

ATGATTGGAGCAAAAGGAAGGTTATACCTATTGGTGCAGTATGTTGTGTCGAAGACGATACAATCACCAAATTTTTTGTAGGCTTCTTTGGAGGCTCCAT[C/T]
CACCCAAAATAAGCTACCAACTGAACCATCAGAACTGCAACTCCATTGTCACGTCCCAAAACGACCCTAAAATATATCCTCTAAATGGTGCCTAGAATAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	41.30%	0.25%	8.84%	NA
All Indica	2759	80.10%	17.80%	0.07%	2.03%	NA
All Japonica	1512	1.40%	79.70%	0.20%	18.72%	NA
Aus	269	21.20%	74.30%	0.00%	4.46%	NA
Indica I	595	67.20%	32.60%	0.00%	0.17%	NA
Indica II	465	86.90%	13.10%	0.00%	0.00%	NA
Indica III	913	92.90%	7.00%	0.00%	0.11%	NA
Indica Intermediate	786	71.10%	21.80%	0.25%	6.87%	NA
Temperate Japonica	767	2.00%	66.20%	0.26%	31.55%	NA
Tropical Japonica	504	0.60%	98.80%	0.00%	0.60%	NA
Japonica Intermediate	241	1.20%	82.60%	0.41%	15.77%	NA
VI/Aromatic	96	17.70%	10.40%	6.25%	65.62%	NA
Intermediate	90	42.20%	52.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710838475	G -> DEL	N	N	silent_mutation	Average:39.36; most accessible tissue: Minghui63 flag leaf, score: 53.617	N	N	N	N
vg0710838475	G -> A	LOC_Os07g18290.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:39.36; most accessible tissue: Minghui63 flag leaf, score: 53.617	N	N	N	N
vg0710838475	G -> A	LOC_Os07g18280.1	upstream_gene_variant ; 2218.0bp to feature; MODIFIER	silent_mutation	Average:39.36; most accessible tissue: Minghui63 flag leaf, score: 53.617	N	N	N	N
vg0710838475	G -> A	LOC_Os07g18300.1	downstream_gene_variant ; 3474.0bp to feature; MODIFIER	silent_mutation	Average:39.36; most accessible tissue: Minghui63 flag leaf, score: 53.617	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710838475	NA	3.43E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710838475	NA	8.14E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710838475	8.62E-06	8.52E-17	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710838475	NA	1.08E-13	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710838475	1.82E-07	1.82E-07	mr1598	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710838475	NA	6.39E-09	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710838475	NA	2.63E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710838475	3.72E-07	3.72E-07	mr1795	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251