Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710825207:

Variant ID: vg0710825207 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10825207
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGTGTTTAGATGGGGCTAAAATTTTCTTAGTCCATGTCACATCGAATGTTTGGACGCTAATTTAAAGTATTAAACATAGACTAATATAAAACCTAATTT[T/C]
ATAAATGAGAGCTAATCCGCGAGACGATTTTTTTAAGCCTAATTAATTCATAATTATCAAAAGTTTACTGTAGCATCACATTGTCAAAATTATGGCGTAA

Reverse complement sequence

TTACGCCATAATTTTGACAATGTGATGCTACAGTAAACTTTTGATAATTATGAATTAATTAGGCTTAAAAAAATCGTCTCGCGGATTAGCTCTCATTTAT[A/G]
AAATTAGGTTTTATATTAGTCTATGTTTAATACTTTAAATTAGCGTCCAAACATTCGATGTGACATGGACTAAGAAAATTTTAGCCCCATCTAAACACCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	28.40%	2.12%	9.44%	NA
All Indica	2759	92.90%	1.70%	2.83%	2.57%	NA
All Japonica	1512	5.80%	75.00%	0.20%	19.05%	NA
Aus	269	41.30%	49.10%	4.83%	4.83%	NA
Indica I	595	97.50%	0.30%	1.85%	0.34%	NA
Indica II	465	92.00%	3.70%	3.23%	1.08%	NA
Indica III	913	94.60%	0.80%	3.94%	0.66%	NA
Indica Intermediate	786	87.90%	2.70%	2.04%	7.38%	NA
Temperate Japonica	767	2.00%	65.70%	0.26%	32.07%	NA
Tropical Japonica	504	13.30%	85.90%	0.20%	0.60%	NA
Japonica Intermediate	241	2.10%	81.70%	0.00%	16.18%	NA
VI/Aromatic	96	25.00%	0.00%	2.08%	72.92%	NA
Intermediate	90	56.70%	34.40%	4.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710825207	T -> DEL	N	N	silent_mutation	Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837	N	N	N	N
vg0710825207	T -> C	LOC_Os07g18250.1	upstream_gene_variant ; 124.0bp to feature; MODIFIER	silent_mutation	Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837	N	N	N	N
vg0710825207	T -> C	LOC_Os07g18260.1	upstream_gene_variant ; 407.0bp to feature; MODIFIER	silent_mutation	Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837	N	N	N	N
vg0710825207	T -> C	LOC_Os07g18250.2	upstream_gene_variant ; 124.0bp to feature; MODIFIER	silent_mutation	Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837	N	N	N	N
vg0710825207	T -> C	LOC_Os07g18270.1	downstream_gene_variant ; 2618.0bp to feature; MODIFIER	silent_mutation	Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837	N	N	N	N
vg0710825207	T -> C	LOC_Os07g18250-LOC_Os07g18260	intergenic_region ; MODIFIER	silent_mutation	Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710825207	NA	1.48E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	4.65E-49	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	3.41E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	4.22E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	1.14E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	2.14E-08	mr1946	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	1.00E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	1.30E-13	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207	NA	2.91E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251