Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710495043:

Variant ID: vg0710495043 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10495043
Reference Allele: G	Alternative Allele: C,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGTTTCGGCGAGGGGAGGCAGCAACCGAGGGGCGGACGGTCTTCACCTCGCTCCTGCGATCCCGAGGGTAGCGACGGCGAGCGAAGGCGGCGATGGAC[G/C,A]
GCGACGAGCGGCACGGCTGAAAACGAGTCGACGGAAGATTGCCTCGGGTTGACAGCGACGACGAAGCTCCGATGGTTTGCAGCGGTGGCGAAGGGGTGGA

Reverse complement sequence

TCCACCCCTTCGCCACCGCTGCAAACCATCGGAGCTTCGTCGTCGCTGTCAACCCGAGGCAATCTTCCGTCGACTCGTTTTCAGCCGTGCCGCTCGTCGC[C/G,T]
GTCCATCGCCGCCTTCGCTCGCCGTCGCTACCCTCGGGATCGCAGGAGCGAGGTGAAGACCGTCCGCCCCTCGGTTGCTGCCTCCCCTCGCCGAAACGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	3.60%	0.97%	3.62%	A: 0.32%
All Indica	2759	99.90%	0.00%	0.07%	0.00%	A: 0.04%
All Japonica	1512	79.70%	11.20%	1.12%	7.87%	A: 0.13%
Aus	269	82.90%	0.00%	1.12%	15.61%	A: 0.37%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.00%	0.00%	A: 0.11%
Indica Intermediate	786	99.70%	0.00%	0.25%	0.00%	NA
Temperate Japonica	767	74.10%	17.60%	1.83%	6.52%	NA
Tropical Japonica	504	85.50%	0.20%	0.20%	13.69%	A: 0.40%
Japonica Intermediate	241	85.50%	13.70%	0.83%	0.00%	NA
VI/Aromatic	96	59.40%	1.00%	20.83%	9.38%	A: 9.38%
Intermediate	90	92.20%	0.00%	4.44%	1.11%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710495043	G -> DEL	N	N	silent_mutation	Average:51.663; most accessible tissue: Callus, score: 93.013	N	N	N	N
vg0710495043	G -> A	LOC_Os07g17760.1	upstream_gene_variant ; 2499.0bp to feature; MODIFIER	silent_mutation	Average:51.663; most accessible tissue: Callus, score: 93.013	N	N	N	N
vg0710495043	G -> A	LOC_Os07g17770.1	upstream_gene_variant ; 4722.0bp to feature; MODIFIER	silent_mutation	Average:51.663; most accessible tissue: Callus, score: 93.013	N	N	N	N
vg0710495043	G -> A	LOC_Os07g17760-LOC_Os07g17770	intergenic_region ; MODIFIER	silent_mutation	Average:51.663; most accessible tissue: Callus, score: 93.013	N	N	N	N
vg0710495043	G -> C	LOC_Os07g17760.1	upstream_gene_variant ; 2499.0bp to feature; MODIFIER	silent_mutation	Average:51.663; most accessible tissue: Callus, score: 93.013	N	N	N	N
vg0710495043	G -> C	LOC_Os07g17770.1	upstream_gene_variant ; 4722.0bp to feature; MODIFIER	silent_mutation	Average:51.663; most accessible tissue: Callus, score: 93.013	N	N	N	N
vg0710495043	G -> C	LOC_Os07g17760-LOC_Os07g17770	intergenic_region ; MODIFIER	silent_mutation	Average:51.663; most accessible tissue: Callus, score: 93.013	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710495043	NA	4.08E-09	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0710495043	NA	3.11E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710495043	NA	1.06E-09	mr1624	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710495043	NA	9.77E-06	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710495043	NA	8.95E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251