| Variant ID: vg0710470183 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10470183 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTATATGTTTGTTCTGCAAGATTCAGATCCGGATATGCATAATAGGGATTCATGGCTTTAAGCTTATCTCCTACGCTTCAGGAATAGATCAGTCAGAACA[C/T]
CATCACCGGCTCACCGTCGTCGCCGCCGACTGGTGTCTTCGCCTATACGGTTGGATGGTCACATCACCGTTGTTGGGCGTCTATGTCTTCACAGCCGACT
AGTCGGCTGTGAAGACATAGACGCCCAACAACGGTGATGTGACCATCCAACCGTATAGGCGAAGACACCAGTCGGCGGCGACGACGGTGAGCCGGTGATG[G/A]
TGTTCTGACTGATCTATTCCTGAAGCGTAGGAGATAAGCTTAAAGCCATGAATCCCTATTATGCATATCCGGATCTGAATCTTGCAGAACAAACATATAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 35.90% | 0.28% | 2.48% | NA |
| All Indica | 2759 | 94.70% | 4.90% | 0.40% | 0.07% | NA |
| All Japonica | 1512 | 5.70% | 90.30% | 0.00% | 3.97% | NA |
| Aus | 269 | 46.10% | 52.40% | 0.37% | 1.12% | NA |
| Indica I | 595 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 0.90% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 10.80% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 1.80% | 90.70% | 0.00% | 7.43% | NA |
| Tropical Japonica | 504 | 13.30% | 86.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 27.10% | 22.90% | 0.00% | 50.00% | NA |
| Intermediate | 90 | 57.80% | 36.70% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710470183 | C -> DEL | N | N | silent_mutation | Average:65.354; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| vg0710470183 | C -> T | LOC_Os07g17720.1 | upstream_gene_variant ; 2574.0bp to feature; MODIFIER | silent_mutation | Average:65.354; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| vg0710470183 | C -> T | LOC_Os07g17730.1 | downstream_gene_variant ; 524.0bp to feature; MODIFIER | silent_mutation | Average:65.354; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| vg0710470183 | C -> T | LOC_Os07g17720-LOC_Os07g17730 | intergenic_region ; MODIFIER | silent_mutation | Average:65.354; most accessible tissue: Minghui63 flag leaf, score: 86.618 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710470183 | NA | 3.69E-34 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710470183 | NA | 1.42E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710470183 | 5.47E-06 | 1.30E-06 | mr1253_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710470183 | NA | 3.48E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710470183 | NA | 1.81E-22 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |