Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710453528:

Variant ID: vg0710453528 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10453528
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCTCGCCTCCGCGTCGCCAAGCGTTGCGCCGGCCGCGTCTCGCCTTCATGCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTTCGCCTCCGTCGTCCC[C/T]
GAGCCGTCTCCGCCACGCTCGTTCATCGTTGTCGTTCCCACGCCTCGTCGCGTGGTGGTAAGGATCCGTCCTCTCGCTGCCCCGTCCTAGTCCTTTCGGT

Reverse complement sequence

ACCGAAAGGACTAGGACGGGGCAGCGAGAGGACGGATCCTTACCACCACGCGACGAGGCGTGGGAACGACAACGATGAACGAGCGTGGCGGAGACGGCTC[G/A]
GGGACGACGGAGGCGAACGGCGAGGGAACGACTTCGGCGGCGATCCTTGCATGAAGGCGAGACGCGGCCGGCGCAACGCTTGGCGACGCGGAGGCGAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.10%	9.70%	0.85%	0.42%	NA
All Indica	2759	99.30%	0.40%	0.25%	0.00%	NA
All Japonica	1512	79.20%	20.50%	0.13%	0.13%	NA
Aus	269	51.70%	46.50%	1.49%	0.37%	NA
Indica I	595	99.00%	0.20%	0.84%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.10%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	39.90%	59.70%	0.20%	0.20%	NA
Japonica Intermediate	241	95.40%	3.70%	0.41%	0.41%	NA
VI/Aromatic	96	56.20%	2.10%	27.08%	14.58%	NA
Intermediate	90	86.70%	8.90%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710453528	C -> DEL	N	N	silent_mutation	Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0710453528	C -> T	LOC_Os07g17700.1	downstream_gene_variant ; 1574.0bp to feature; MODIFIER	silent_mutation	Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0710453528	C -> T	LOC_Os07g17710.1	downstream_gene_variant ; 4692.0bp to feature; MODIFIER	silent_mutation	Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N
vg0710453528	C -> T	LOC_Os07g17700-LOC_Os07g17710	intergenic_region ; MODIFIER	silent_mutation	Average:58.985; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710453528	NA	9.05E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	4.24E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	7.32E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	2.75E-09	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	2.28E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	1.92E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	8.48E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	5.20E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	1.29E-07	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	2.95E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	4.53E-09	mr1277_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	7.73E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	7.03E-13	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	1.96E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	8.60E-06	mr1378_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	4.29E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	9.22E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710453528	NA	2.57E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251