Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710292737:

Variant ID: vg0710292737 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10292737
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACACAGCGGGACCGCCGTGTGCGTTGCCCCTTAGATTTCGCTTAGGGTTTTATATCTATCTTACTTTTTATTACTATTGTATATTTGATATGACATGGTA[G/A]
GATAGATCCCCTCAGAAAAATTAAGTGTAATTTATGCTCTTCCAATAATTGCACCTATTACGGTTGTGATCATAAGTGATGGGTTTGCCATAGCAAAGTG

Reverse complement sequence

CACTTTGCTATGGCAAACCCATCACTTATGATCACAACCGTAATAGGTGCAATTATTGGAAGAGCATAAATTACACTTAATTTTTCTGAGGGGATCTATC[C/T]
TACCATGTCATATCAAATATACAATAGTAATAAAAAGTAAGATAGATATAAAACCCTAAGCGAAATCTAAGGGGCAACGCACACGGCGGTCCCGCTGTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	36.30%	0.38%	7.15%	NA
All Indica	2759	90.70%	4.00%	0.29%	5.04%	NA
All Japonica	1512	1.30%	94.10%	0.00%	4.56%	NA
Aus	269	26.00%	54.60%	2.60%	16.73%	NA
Indica I	595	96.50%	0.80%	0.34%	2.35%	NA
Indica II	465	91.80%	3.70%	0.22%	4.30%	NA
Indica III	913	93.40%	0.30%	0.11%	6.13%	NA
Indica Intermediate	786	82.60%	10.70%	0.51%	6.23%	NA
Temperate Japonica	767	1.80%	98.00%	0.00%	0.13%	NA
Tropical Japonica	504	0.60%	87.10%	0.00%	12.30%	NA
Japonica Intermediate	241	1.20%	96.30%	0.00%	2.49%	NA
VI/Aromatic	96	17.70%	4.20%	2.08%	76.04%	NA
Intermediate	90	47.80%	37.80%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710292737	G -> DEL	N	N	silent_mutation	Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0710292737	G -> A	LOC_Os07g17440.1	upstream_gene_variant ; 720.0bp to feature; MODIFIER	silent_mutation	Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0710292737	G -> A	LOC_Os07g17430.1	downstream_gene_variant ; 1587.0bp to feature; MODIFIER	silent_mutation	Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0710292737	G -> A	LOC_Os07g17430-LOC_Os07g17440	intergenic_region ; MODIFIER	silent_mutation	Average:35.038; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710292737	NA	2.49E-15	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710292737	NA	4.43E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710292737	NA	5.23E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710292737	7.14E-06	1.80E-10	mr1716	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710292737	NA	8.49E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710292737	NA	4.97E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251