Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709749074:

Variant ID: vg0709749074 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9749074
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTGAGAGGGTTGGGCAGAAACGTGGGTGAGCAAAAGGTTTGAATGATTTTAAGGATTATTTCTCTCTCCCACTTTAGTAATTCAATTATTTAATTTGTG[C/G]
GTAGAATAATTTAGTGTGGATTTTTCTGAAGGTAGACGAAGATACCTAGATTCCATTTTCTTTGGTTGCACTAAAAAATTATGGATAGATTACTCACAGA

Reverse complement sequence

TCTGTGAGTAATCTATCCATAATTTTTTAGTGCAACCAAAGAAAATGGAATCTAGGTATCTTCGTCTACCTTCAGAAAAATCCACACTAAATTATTCTAC[G/C]
CACAAATTAAATAATTGAATTACTAAAGTGGGAGAGAGAAATAATCCTTAAAATCATTCAAACCTTTTGCTCACCCACGTTTCTGCCCAACCCTCTCACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	33.10%	15.00%	6.62%	NA
All Indica	2759	62.90%	9.40%	22.47%	5.26%	NA
All Japonica	1512	14.60%	71.40%	3.90%	10.05%	NA
Aus	269	31.60%	61.70%	4.83%	1.86%	NA
Indica I	595	56.00%	23.50%	11.43%	9.08%	NA
Indica II	465	47.50%	5.40%	38.92%	8.17%	NA
Indica III	913	76.10%	1.00%	22.23%	0.66%	NA
Indica Intermediate	786	61.80%	10.80%	21.37%	5.98%	NA
Temperate Japonica	767	14.70%	71.70%	6.91%	6.65%	NA
Tropical Japonica	504	5.20%	83.10%	0.20%	11.51%	NA
Japonica Intermediate	241	34.00%	46.10%	2.07%	17.84%	NA
VI/Aromatic	96	63.50%	20.80%	9.38%	6.25%	NA
Intermediate	90	42.20%	43.30%	8.89%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709749074	C -> DEL	N	N	silent_mutation	Average:63.294; most accessible tissue: Callus, score: 86.787	N	N	N	N
vg0709749074	C -> G	LOC_Os07g16610.1	upstream_gene_variant ; 448.0bp to feature; MODIFIER	silent_mutation	Average:63.294; most accessible tissue: Callus, score: 86.787	N	N	N	N
vg0709749074	C -> G	LOC_Os07g16620.1	downstream_gene_variant ; 1277.0bp to feature; MODIFIER	silent_mutation	Average:63.294; most accessible tissue: Callus, score: 86.787	N	N	N	N
vg0709749074	C -> G	LOC_Os07g16610-LOC_Os07g16620	intergenic_region ; MODIFIER	silent_mutation	Average:63.294; most accessible tissue: Callus, score: 86.787	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709749074	NA	8.47E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	4.94E-06	NA	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	4.22E-06	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	6.49E-07	NA	mr1247	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	NA	7.59E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	NA	5.62E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	NA	8.45E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	NA	1.33E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	NA	3.76E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	NA	8.13E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709749074	NA	2.96E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251