Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709678550:

Variant ID: vg0709678550 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9678550
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCAGCAATGGCGCATAAATACTTCTGGTATATTATGGTTACAGAGTTCATCCGCAGGCGCACGGACATACCATTATACCGTTTCACCCGAGAGTATTC[C/T]
AAGGGTATTGTATTTATTTTATCCCGTGGCAAGATCATGTAGAGATAACTCAACTAATAATTTATATATTACTTGAGATAATCATATTCTAAGCAGGGGT

Reverse complement sequence

ACCCCTGCTTAGAATATGATTATCTCAAGTAATATATAAATTATTAGTTGAGTTATCTCTACATGATCTTGCCACGGGATAAAATAAATACAATACCCTT[G/A]
GAATACTCTCGGGTGAAACGGTATAATGGTATGTCCGTGCGCCTGCGGATGAACTCTGTAACCATAATATACCAGAAGTATTTATGCGCCATTGCTGGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.60%	46.50%	2.81%	4.04%	NA
All Indica	2759	75.90%	16.80%	2.54%	4.75%	NA
All Japonica	1512	1.40%	91.50%	3.64%	3.44%	NA
Aus	269	13.40%	84.80%	0.00%	1.86%	NA
Indica I	595	59.70%	27.40%	4.54%	8.40%	NA
Indica II	465	88.00%	6.70%	1.29%	4.09%	NA
Indica III	913	88.70%	7.00%	2.30%	1.97%	NA
Indica Intermediate	786	66.20%	26.20%	2.04%	5.60%	NA
Temperate Japonica	767	1.80%	95.30%	0.13%	2.74%	NA
Tropical Japonica	504	0.80%	88.10%	10.12%	0.99%	NA
Japonica Intermediate	241	1.20%	86.70%	1.24%	10.79%	NA
VI/Aromatic	96	15.60%	77.10%	5.21%	2.08%	NA
Intermediate	90	41.10%	54.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709678550	C -> DEL	N	N	silent_mutation	Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69	N	N	N	N
vg0709678550	C -> T	LOC_Os07g16510.1	upstream_gene_variant ; 509.0bp to feature; MODIFIER	silent_mutation	Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69	N	N	N	N
vg0709678550	C -> T	LOC_Os07g16500.1	downstream_gene_variant ; 2719.0bp to feature; MODIFIER	silent_mutation	Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69	N	N	N	N
vg0709678550	C -> T	LOC_Os07g16520.1	downstream_gene_variant ; 4591.0bp to feature; MODIFIER	silent_mutation	Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69	N	N	N	N
vg0709678550	C -> T	LOC_Os07g16510-LOC_Os07g16520	intergenic_region ; MODIFIER	silent_mutation	Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709678550	NA	1.26E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550	NA	1.31E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550	NA	6.52E-33	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550	1.27E-06	NA	mr1624_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550	NA	2.35E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550	NA	1.30E-08	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550	NA	7.34E-32	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550	NA	4.93E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251