| Variant ID: vg0709675339 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9675339 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAGCCCGTTCTGTGGCAAGCCTAATGAGGATGCCAACGCTCATCTGCAACAATTCCTGGAGATATGTAGCACGTACACCATCAAGGGCGACAGTCCCGA[T/C]
GCCGTCAGGCTGCGACTGTTTTCGATCTTCCTCCTCGGGAGAGCGAAGCAGTGGTTTTATGCCAACCGTGCTGCTGTCAACACCTGGGATAAATGCTCTA
TAGAGCATTTATCCCAGGTGTTGACAGCAGCACGGTTGGCATAAAACCACTGCTTCGCTCTCCCGAGGAGGAAGATCGAAAACAGTCGCAGCCTGACGGC[A/G]
TCGGGACTGTCGCCCTTGATGGTGTACGTGCTACATATCTCCAGGAATTGTTGCAGATGAGCGTTGGCATCCTCATTAGGCTTGCCACAGAACGGGCTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 40.90% | 2.31% | 0.17% | NA |
| All Indica | 2759 | 86.60% | 12.50% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 7.90% | 86.90% | 4.70% | 0.53% | NA |
| Aus | 269 | 33.10% | 65.80% | 1.12% | 0.00% | NA |
| Indica I | 595 | 71.90% | 26.20% | 1.85% | 0.00% | NA |
| Indica II | 465 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 19.70% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 11.00% | 86.20% | 2.35% | 0.52% | NA |
| Tropical Japonica | 504 | 4.60% | 88.50% | 6.94% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 85.90% | 7.47% | 1.66% | NA |
| VI/Aromatic | 96 | 40.60% | 53.10% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 50.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709675339 | T -> DEL | LOC_Os07g16500.1 | N | frameshift_variant | Average:50.127; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0709675339 | T -> C | LOC_Os07g16500.1 | synonymous_variant ; p.Asp119Asp; LOW | synonymous_codon | Average:50.127; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709675339 | 2.87E-06 | 5.33E-09 | mr1026 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709675339 | NA | 2.03E-07 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709675339 | 6.00E-06 | 6.40E-08 | mr1161 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709675339 | NA | 9.54E-15 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709675339 | NA | 2.97E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709675339 | NA | 4.58E-30 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709675339 | NA | 7.13E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709675339 | NA | 1.76E-29 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |