Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709588264:

Variant ID: vg0709588264 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9588264
Reference Allele: C	Alternative Allele: T,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAATTATTAAGCAACAACAACAAATAACAAAGTTTATTAAAAAGAAAAACTAAAAATAAACCCTCTCCTCCCTTTGGGCCAAGTCCAGCCCAAAGCCTC[C/T,G]
CTCTCTCTCCCTCGGCCCGCGGCCGAAGTCCTTCCCTCCTCCCTCTCTTTTTTCTTCCGGAATAAGTTCACTTTGGGTCCCTCTATTTGTCGCCCAGTCC

Reverse complement sequence

GGACTGGGCGACAAATAGAGGGACCCAAAGTGAACTTATTCCGGAAGAAAAAAGAGAGGGAGGAGGGAAGGACTTCGGCCGCGGGCCGAGGGAGAGAGAG[G/A,C]
GAGGCTTTGGGCTGGACTTGGCCCAAAGGGAGGAGAGGGTTTATTTTTAGTTTTTCTTTTTAATAAACTTTGTTATTTGTTGTTGTTGCTTAATAATTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.60%	45.40%	0.38%	4.13%	G: 1.50%
All Indica	2759	79.30%	20.40%	0.11%	0.18%	NA
All Japonica	1512	1.20%	84.10%	0.66%	10.12%	G: 3.90%
Aus	269	14.10%	81.40%	0.74%	3.72%	NA
Indica I	595	64.50%	35.30%	0.17%	0.00%	NA
Indica II	465	89.00%	10.30%	0.22%	0.43%	NA
Indica III	913	91.30%	8.70%	0.00%	0.00%	NA
Indica Intermediate	786	70.60%	28.90%	0.13%	0.38%	NA
Temperate Japonica	767	1.40%	89.60%	0.65%	8.21%	G: 0.13%
Tropical Japonica	504	0.80%	83.70%	0.00%	4.37%	G: 11.11%
Japonica Intermediate	241	1.20%	67.60%	2.07%	28.22%	G: 0.83%
VI/Aromatic	96	15.60%	55.20%	1.04%	21.88%	G: 6.25%
Intermediate	90	41.10%	43.30%	2.22%	6.67%	G: 6.67%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709588264	C -> DEL	N	N	silent_mutation	Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N
vg0709588264	C -> G	LOC_Os07g16400.1	upstream_gene_variant ; 1250.0bp to feature; MODIFIER	silent_mutation	Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N
vg0709588264	C -> G	LOC_Os07g16380-LOC_Os07g16400	intergenic_region ; MODIFIER	silent_mutation	Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N
vg0709588264	C -> T	LOC_Os07g16400.1	upstream_gene_variant ; 1250.0bp to feature; MODIFIER	silent_mutation	Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N
vg0709588264	C -> T	LOC_Os07g16380-LOC_Os07g16400	intergenic_region ; MODIFIER	silent_mutation	Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709588264	NA	1.07E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264	NA	2.99E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264	2.29E-06	2.91E-17	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264	3.69E-07	3.69E-07	mr1270	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264	NA	6.49E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264	NA	6.87E-06	mr1468	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264	NA	1.07E-09	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264	NA	1.95E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251