| Variant ID: vg0709292761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9292761 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGGAGAGGGAGAGAGGATTGGGATGTTTTTCAAAATGATTAATCTAACAACCTAAAATAATGGGTCAGATGTTTATGTTGAAACCGATGGTAAGATGTT[T/A]
TGTTTTCTTGTCAGAATTTTATTAGGATTTTATTTGATTTAAGAGAACGACGTAACATCTTAACAACATTTATAAAATGTGTAATGGACTTTTAACACCG
CGGTGTTAAAAGTCCATTACACATTTTATAAATGTTGTTAAGATGTTACGTCGTTCTCTTAAATCAAATAAAATCCTAATAAAATTCTGACAAGAAAACA[A/T]
AACATCTTACCATCGGTTTCAACATAAACATCTGACCCATTATTTTAGGTTGTTAGATTAATCATTTTGAAAAACATCCCAATCCTCTCTCCCTCTCCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.80% | 5.10% | 4.57% | 53.51% | NA |
| All Indica | 2759 | 9.80% | 0.00% | 7.58% | 82.60% | NA |
| All Japonica | 1512 | 79.20% | 16.00% | 0.13% | 4.63% | NA |
| Aus | 269 | 66.90% | 0.00% | 0.74% | 32.34% | NA |
| Indica I | 595 | 7.60% | 0.00% | 17.65% | 74.79% | NA |
| Indica II | 465 | 6.90% | 0.00% | 3.87% | 89.25% | NA |
| Indica III | 913 | 7.90% | 0.00% | 5.37% | 86.75% | NA |
| Indica Intermediate | 786 | 15.50% | 0.00% | 4.71% | 79.77% | NA |
| Temperate Japonica | 767 | 78.10% | 20.30% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 88.10% | 1.20% | 0.40% | 10.32% | NA |
| Japonica Intermediate | 241 | 64.30% | 33.20% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 50.00% | 1.00% | 2.08% | 46.88% | NA |
| Intermediate | 90 | 45.60% | 0.00% | 1.11% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709292761 | T -> DEL | N | N | silent_mutation | Average:8.97; most accessible tissue: Callus, score: 43.967 | N | N | N | N |
| vg0709292761 | T -> A | LOC_Os07g15970.1 | upstream_gene_variant ; 4972.0bp to feature; MODIFIER | silent_mutation | Average:8.97; most accessible tissue: Callus, score: 43.967 | N | N | N | N |
| vg0709292761 | T -> A | LOC_Os07g15959-LOC_Os07g15970 | intergenic_region ; MODIFIER | silent_mutation | Average:8.97; most accessible tissue: Callus, score: 43.967 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709292761 | NA | 5.85E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0709292761 | NA | 5.99E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | NA | 3.82E-06 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | 2.65E-07 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | NA | 1.75E-11 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | NA | 3.17E-11 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | NA | 4.08E-08 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | 1.98E-07 | 1.97E-07 | mr1736 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | NA | 4.23E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709292761 | NA | 1.92E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |