Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709095039:

Variant ID: vg0709095039 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9095039
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATGTCATTTTGCAAAGTTTATTTGGAGAGCTGTATAGTTCTCTTTTGGTCTTTACCCTCCTAATTGCATATCTCATATTTTTTATGATTGGCTTCTGG[G/A]
GGTAGACAAGAAAAATAGGAAACTTATTCTCATAGGAGCTTCTGTTATATATTGGGCTCTATGGTTGAGTAGGAATGATATGATTTTTGACAAATCACCA

Reverse complement sequence

TGGTGATTTGTCAAAAATCATATCATTCCTACTCAACCATAGAGCCCAATATATAACAGAAGCTCCTATGAGAATAAGTTTCCTATTTTTCTTGTCTACC[C/T]
CCAGAAGCCAATCATAAAAAATATGAGATATGCAATTAGGAGGGTAAAGACCAAAAGAGAACTATACAGCTCTCCAAATAAACTTTGCAAAATGACATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.30%	3.40%	1.97%	13.35%	NA
All Indica	2759	74.00%	0.50%	2.90%	22.58%	NA
All Japonica	1512	99.40%	0.50%	0.07%	0.07%	NA
Aus	269	43.50%	52.40%	4.09%	0.00%	NA
Indica I	595	21.30%	0.20%	8.24%	70.25%	NA
Indica II	465	90.80%	0.00%	1.72%	7.53%	NA
Indica III	913	99.50%	0.10%	0.00%	0.44%	NA
Indica Intermediate	786	74.60%	1.40%	2.93%	21.12%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	1.10%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709095039	G -> DEL	N	N	silent_mutation	Average:18.269; most accessible tissue: Callus, score: 25.814	N	N	N	N
vg0709095039	G -> A	LOC_Os07g15670.1	upstream_gene_variant ; 4058.0bp to feature; MODIFIER	silent_mutation	Average:18.269; most accessible tissue: Callus, score: 25.814	N	N	N	N
vg0709095039	G -> A	LOC_Os07g15670.3	upstream_gene_variant ; 4058.0bp to feature; MODIFIER	silent_mutation	Average:18.269; most accessible tissue: Callus, score: 25.814	N	N	N	N
vg0709095039	G -> A	LOC_Os07g15670.2	upstream_gene_variant ; 4058.0bp to feature; MODIFIER	silent_mutation	Average:18.269; most accessible tissue: Callus, score: 25.814	N	N	N	N
vg0709095039	G -> A	LOC_Os07g15660.1	intron_variant ; MODIFIER	silent_mutation	Average:18.269; most accessible tissue: Callus, score: 25.814	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709095039	NA	1.16E-41	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039	NA	3.32E-39	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039	8.13E-06	NA	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039	NA	7.28E-34	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039	2.52E-09	4.34E-54	mr1550_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039	NA	3.58E-31	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251