Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708267234:

Variant ID: vg0708267234 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8267234
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.21, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCAAAAATTCAAATTTTGGCTTATTCTTTGGCTGTTTAGGCCAAACGATGGGGCTCAGATACTCCCTCCGTTTCACAATGTAAGTCATTCTAGCATTT[T/C]
CCACATTCATATTGATGTTAATGAATCTAAACATATATATATATCTAGATTCATTAACATCAATTTGAATGTGGAAAATGCTAGAATGACTTACATTGTG

Reverse complement sequence

CACAATGTAAGTCATTCTAGCATTTTCCACATTCAAATTGATGTTAATGAATCTAGATATATATATATGTTTAGATTCATTAACATCAATATGAATGTGG[A/G]
AAATGCTAGAATGACTTACATTGTGAAACGGAGGGAGTATCTGAGCCCCATCGTTTGGCCTAAACAGCCAAAGAATAAGCCAAAATTTGAATTTTTGAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.90%	34.90%	13.86%	3.28%	NA
All Indica	2759	71.80%	2.90%	19.75%	5.58%	NA
All Japonica	1512	8.10%	85.40%	6.42%	0.07%	NA
Aus	269	40.90%	58.70%	0.37%	0.00%	NA
Indica I	595	59.20%	1.70%	33.78%	5.38%	NA
Indica II	465	77.00%	6.70%	11.61%	4.73%	NA
Indica III	913	82.00%	0.70%	14.02%	3.29%	NA
Indica Intermediate	786	66.40%	4.10%	20.61%	8.91%	NA
Temperate Japonica	767	4.80%	83.10%	11.99%	0.13%	NA
Tropical Japonica	504	11.70%	88.10%	0.20%	0.00%	NA
Japonica Intermediate	241	10.80%	87.60%	1.66%	0.00%	NA
VI/Aromatic	96	19.80%	77.10%	3.12%	0.00%	NA
Intermediate	90	37.80%	52.20%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708267234	T -> DEL	N	N	silent_mutation	Average:60.168; most accessible tissue: Zhenshan97 flag leaf, score: 86.884	N	N	N	N
vg0708267234	T -> C	LOC_Os07g14514.1	intron_variant ; MODIFIER	silent_mutation	Average:60.168; most accessible tissue: Zhenshan97 flag leaf, score: 86.884	N	N	N	N
vg0708267234	T -> C	LOC_Os07g14514.5	intron_variant ; MODIFIER	silent_mutation	Average:60.168; most accessible tissue: Zhenshan97 flag leaf, score: 86.884	N	N	N	N
vg0708267234	T -> C	LOC_Os07g14514.3	intron_variant ; MODIFIER	silent_mutation	Average:60.168; most accessible tissue: Zhenshan97 flag leaf, score: 86.884	N	N	N	N
vg0708267234	T -> C	LOC_Os07g14514.2	intron_variant ; MODIFIER	silent_mutation	Average:60.168; most accessible tissue: Zhenshan97 flag leaf, score: 86.884	N	N	N	N
vg0708267234	T -> C	LOC_Os07g14514.4	intron_variant ; MODIFIER	silent_mutation	Average:60.168; most accessible tissue: Zhenshan97 flag leaf, score: 86.884	N	N	N	N
vg0708267234	T -> C	LOC_Os07g14514.6	intron_variant ; MODIFIER	silent_mutation	Average:60.168; most accessible tissue: Zhenshan97 flag leaf, score: 86.884	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708267234	NA	3.05E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	NA	1.43E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	NA	5.97E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	NA	7.61E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	NA	1.05E-06	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	NA	1.21E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	NA	7.59E-14	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	NA	2.99E-06	mr1852_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708267234	2.26E-06	5.27E-08	mr1872_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251