Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707873071:

Variant ID: vg0707873071 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 7873071
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGCCAATATACGCCAAGACATGCTGCCGGATATCGACTTCAGGGATAGGCATGAATATTCCCCTACGGTGTCTCCGGATACCGTCAGGAGATACGAAAG[C/A]
GCTAACTCTGATCTCGCCGGGCACAGATCTGAGGAGGAAGACTACCCTGTTGTCGACTACGAGTTATACCTTTAGACCAACATGTCGACAACAGTTAGAT

Reverse complement sequence

ATCTAACTGTTGTCGACATGTTGGTCTAAAGGTATAACTCGTAGTCGACAACAGGGTAGTCTTCCTCCTCAGATCTGTGCCCGGCGAGATCAGAGTTAGC[G/T]
CTTTCGTATCTCCTGACGGTATCCGGAGACACCGTAGGGGAATATTCATGCCTATCCCTGAAGTCGATATCCGGCAGCATGTCTTGGCGTATATTGGCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	7.60%	0.83%	4.36%	NA
All Indica	2759	91.50%	0.30%	0.83%	7.32%	NA
All Japonica	1512	90.50%	8.90%	0.60%	0.00%	NA
Aus	269	45.40%	53.50%	1.12%	0.00%	NA
Indica I	595	98.70%	0.00%	0.84%	0.50%	NA
Indica II	465	91.80%	0.00%	1.51%	6.67%	NA
Indica III	913	89.30%	0.00%	0.77%	9.97%	NA
Indica Intermediate	786	88.50%	1.10%	0.51%	9.80%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	79.80%	19.40%	0.79%	0.00%	NA
Japonica Intermediate	241	83.80%	14.10%	2.07%	0.00%	NA
VI/Aromatic	96	30.20%	66.70%	3.12%	0.00%	NA
Intermediate	90	86.70%	7.80%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707873071	C -> DEL	N	N	silent_mutation	Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937	N	N	N	N
vg0707873071	C -> A	LOC_Os07g13710.1	upstream_gene_variant ; 425.0bp to feature; MODIFIER	silent_mutation	Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937	N	N	N	N
vg0707873071	C -> A	LOC_Os07g13719.1	upstream_gene_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937	N	N	N	N
vg0707873071	C -> A	LOC_Os07g13728.1	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937	N	N	N	N
vg0707873071	C -> A	LOC_Os07g13710-LOC_Os07g13719	intergenic_region ; MODIFIER	silent_mutation	Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707873071	NA	1.01E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071	NA	3.86E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071	1.37E-06	1.31E-08	mr1083	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071	NA	9.00E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071	NA	8.86E-08	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071	NA	1.29E-08	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071	NA	1.68E-06	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071	NA	2.16E-06	mr1819	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251