Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707490731:

Variant ID: vg0707490731 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 7490731
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTTTTAAAAGATTTAAATCACGCAGGTGGTAATTTCATATGTTAATTAGAGTTTTTAACAATTAATTTACTATCATTCATATGCTAATTATATATGA[T/C]
TATTCGAATTTTTAAAAGTTTTAAATCATGCATGTGGCATTTACATATGTTAATTAGAGTTTTTCACAATTTAATTTACTATCACTCATATGCTAATTAT

Reverse complement sequence

ATAATTAGCATATGAGTGATAGTAAATTAAATTGTGAAAAACTCTAATTAACATATGTAAATGCCACATGCATGATTTAAAACTTTTAAAAATTCGAATA[A/G]
TCATATATAATTAGCATATGAATGATAGTAAATTAATTGTTAAAAACTCTAATTAACATATGAAATTACCACCTGCGTGATTTAAATCTTTTAAAAATTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.20%	5.40%	46.87%	4.57%	NA
All Indica	2759	20.30%	6.00%	72.42%	1.30%	NA
All Japonica	1512	79.70%	0.50%	8.27%	11.57%	NA
Aus	269	59.50%	26.00%	14.50%	0.00%	NA
Indica I	595	15.30%	1.70%	81.01%	2.02%	NA
Indica II	465	15.30%	4.30%	77.20%	3.23%	NA
Indica III	913	20.70%	7.90%	71.30%	0.11%	NA
Indica Intermediate	786	26.50%	8.10%	64.38%	1.02%	NA
Temperate Japonica	767	96.10%	0.00%	2.09%	1.83%	NA
Tropical Japonica	504	67.30%	1.00%	16.87%	14.88%	NA
Japonica Intermediate	241	53.50%	0.80%	9.96%	35.68%	NA
VI/Aromatic	96	77.10%	4.20%	18.75%	0.00%	NA
Intermediate	90	48.90%	6.70%	38.89%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707490731	T -> DEL	N	N	silent_mutation	Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0707490731	T -> C	LOC_Os07g13070.1	upstream_gene_variant ; 2079.0bp to feature; MODIFIER	silent_mutation	Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0707490731	T -> C	LOC_Os07g13060.1	downstream_gene_variant ; 245.0bp to feature; MODIFIER	silent_mutation	Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0707490731	T -> C	LOC_Os07g13060-LOC_Os07g13070	intergenic_region ; MODIFIER	silent_mutation	Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707490731	NA	1.25E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	3.15E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	9.86E-13	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	1.21E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	4.45E-25	mr1416	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	4.77E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	4.02E-11	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	2.21E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	2.45E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731	NA	1.55E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251