Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707315648:

Variant ID: vg0707315648 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 7315648
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTGGATATTTTTTAAGTAGTTAGTTATATAATTAAATTAATTTCTAATTAAAGTAAGTGTGAGAAATAAAATGTTATGGTTGGATTTAATGTTTATT[C/A]
AATTTTCTATATTATTAATTACACTCATTGAAATTTTCGTAGCTTAATTGCTAATTTTGATAATACAAACATCATTTTAGCATTTATTTAAATAAAAATC

Reverse complement sequence

GATTTTTATTTAAATAAATGCTAAAATGATGTTTGTATTATCAAAATTAGCAATTAAGCTACGAAAATTTCAATGAGTGTAATTAATAATATAGAAAATT[G/T]
AATAAACATTAAATCCAACCATAACATTTTATTTCTCACACTTACTTTAATTAGAAATTAATTTAATTATATAACTAACTACTTAAAAAATATCCAAATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	24.80%	0.23%	0.00%	NA
All Indica	2759	95.30%	4.60%	0.11%	0.00%	NA
All Japonica	1512	36.70%	62.90%	0.40%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	93.50%	6.50%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	89.10%	10.60%	0.38%	0.00%	NA
Temperate Japonica	767	4.70%	95.20%	0.13%	0.00%	NA
Tropical Japonica	504	77.40%	21.80%	0.79%	0.00%	NA
Japonica Intermediate	241	53.50%	46.10%	0.41%	0.00%	NA
VI/Aromatic	96	27.10%	71.90%	1.04%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707315648	C -> A	LOC_Os07g12790.1	upstream_gene_variant ; 1402.0bp to feature; MODIFIER	silent_mutation	Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827	N	N	N	N
vg0707315648	C -> A	LOC_Os07g12770.1	downstream_gene_variant ; 2570.0bp to feature; MODIFIER	silent_mutation	Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827	N	N	N	N
vg0707315648	C -> A	LOC_Os07g12780.1	downstream_gene_variant ; 901.0bp to feature; MODIFIER	silent_mutation	Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827	N	N	N	N
vg0707315648	C -> A	LOC_Os07g12780-LOC_Os07g12790	intergenic_region ; MODIFIER	silent_mutation	Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707315648	NA	3.84E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648	6.17E-07	NA	mr1064_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648	NA	1.73E-07	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648	NA	5.49E-11	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648	NA	7.38E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648	NA	1.23E-06	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648	NA	5.13E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251