| Variant ID: vg0707304200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7304200 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTCGCCGCTGTTGGGCGCCTACGACTTCGCCGCCGGCCTGCCTCCGCAGCCGCCGACTGGTGTTTTCGCCTGCACGGCTGGCCTATTATGCCGCCGTTC[T/A]
TGGGCATTCACGTCTTCACCGACCGGCTTGCCTTCGCCGCCGCCGACTGGTGTCTCCACGTACATGGCTGGCCTATTATGCCGCCGTTGGTGGGCATCTA
TAGATGCCCACCAACGGCGGCATAATAGGCCAGCCATGTACGTGGAGACACCAGTCGGCGGCGGCGAAGGCAAGCCGGTCGGTGAAGACGTGAATGCCCA[A/T]
GAACGGCGGCATAATAGGCCAGCCGTGCAGGCGAAAACACCAGTCGGCGGCTGCGGAGGCAGGCCGGCGGCGAAGTCGTAGGCGCCCAACAGCGGCGACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 2.40% | 2.92% | 57.51% | NA |
| All Indica | 2759 | 9.60% | 3.00% | 3.26% | 84.12% | NA |
| All Japonica | 1512 | 79.40% | 1.70% | 1.32% | 17.59% | NA |
| Aus | 269 | 64.70% | 0.40% | 1.86% | 33.09% | NA |
| Indica I | 595 | 9.70% | 2.20% | 4.03% | 84.03% | NA |
| Indica II | 465 | 12.00% | 0.40% | 1.94% | 85.59% | NA |
| Indica III | 913 | 2.50% | 4.30% | 2.96% | 90.25% | NA |
| Indica Intermediate | 786 | 16.20% | 3.80% | 3.82% | 76.21% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 67.50% | 4.40% | 2.78% | 25.40% | NA |
| Japonica Intermediate | 241 | 51.90% | 1.20% | 2.07% | 44.81% | NA |
| VI/Aromatic | 96 | 77.10% | 2.10% | 16.67% | 4.17% | NA |
| Intermediate | 90 | 47.80% | 2.20% | 7.78% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707304200 | T -> DEL | N | N | silent_mutation | Average:12.747; most accessible tissue: Callus, score: 50.06 | N | N | N | N |
| vg0707304200 | T -> A | LOC_Os07g12760-LOC_Os07g12770 | intergenic_region ; MODIFIER | silent_mutation | Average:12.747; most accessible tissue: Callus, score: 50.06 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707304200 | NA | 7.94E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707304200 | 3.15E-06 | 3.15E-06 | mr1190 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707304200 | 4.06E-06 | 4.06E-06 | mr1321 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707304200 | NA | 7.99E-06 | mr1330 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |