Search for Variation information by Variation ID:
Detailed information for vg0707252342:
| Variant ID: vg0707252342 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7252342 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ATCCAAAGCTTCTTCAGGTTTCATCTCAAATTTAATATACTCCTTTTTGAAAAGATCTCGACGAAGCTCTTTAATGTTATTTGTTCCTTGATGAAAATTA[C/T]
TCAAAGCAACCCAAATCTCATGAGCAGTTTGAAGATGAGCAATACGATCATAATCCGAACGAGAAATACCACTCAAAAGAATGTTACGAGCTTTGCAATT
Reverse complement sequence
AATTGCAAAGCTCGTAACATTCTTTTGAGTGGTATTTCTCGTTCGGATTATGATCGTATTGCTCATCTTCAAACTGCTCATGAGATTTGGGTTGCTTTGA[G/A]
TAATTTTCATCAAGGAACAAATAACATTAAAGAGCTTCGTCGAGATCTTTTCAAAAAGGAGTATATTAAATTTGAGATGAAACCTGAAGAAGCTTTGGAT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.00% | 0.40% | 0.11% | 0.44% | NA |
| All Indica | 2759 | 98.80% | 0.70% | 0.18% | 0.36% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.00% | 0.73% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.10% | 0.90% | 0.33% | 0.66% | NA |
| Indica Intermediate | 786 | 98.30% | 1.00% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 0.00% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707252342 | C -> DEL | LOC_Os07g12690.1 | N | frameshift_variant | Average:4.881; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0707252342 | C -> T | LOC_Os07g12690.1 | missense_variant ; p.Ser96Asn; MODERATE | nonsynonymous_codon ; S96N | Average:4.881; most accessible tissue: Minghui63 panicle, score: 7.125 | benign  |
0.481 |
TOLERATED | 0.17 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707252342 | 3.53E-06 | NA | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707252342 | 7.74E-06 | NA | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707252342 | 5.17E-06 | NA | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707252342 | 9.80E-08 | 8.55E-06 | mr1536 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707252342 | 1.79E-06 | 1.79E-06 | mr1778 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |