Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706863183:

Variant ID: vg0706863183 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6863183
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAGCCTAAAAGAACAGAAAAAGAAACGCACAAAGACACAGAGTACAGAGGAATAAGTTCACTTCATGACCCTCAAAAGAGACCCGAATCTAATCCATG[A/G]
CCCTAAACCGCAAAACCGGATATCTTCACCCCCAAACTATTGAAACCGGTGCAATTTGACTCCCTTGGTGGTTTTGGATGGCGGTTTCGCTGACGTGGCG

Reverse complement sequence

CGCCACGTCAGCGAAACCGCCATCCAAAACCACCAAGGGAGTCAAATTGCACCGGTTTCAATAGTTTGGGGGTGAAGATATCCGGTTTTGCGGTTTAGGG[T/C]
CATGGATTAGATTCGGGTCTCTTTTGAGGGTCATGAAGTGAACTTATTCCTCTGTACTCTGTGTCTTTGTGCGTTTCTTTTTCTGTTCTTTTAGGCTATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 1.00% 12.12% 35.10% NA
All Indica  2759 19.40% 1.60% 20.22% 58.79% NA
All Japonica  1512 99.70% 0.00% 0.07% 0.26% NA
Aus  269 93.70% 0.00% 1.86% 4.46% NA
Indica I  595 13.90% 1.00% 17.48% 67.56% NA
Indica II  465 18.90% 0.60% 15.70% 64.73% NA
Indica III  913 19.50% 2.50% 26.62% 51.37% NA
Indica Intermediate  786 23.50% 1.70% 17.56% 57.25% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 67.80% 0.00% 8.89% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706863183 A -> DEL N N silent_mutation Average:63.017; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0706863183 A -> G LOC_Os07g12250.1 upstream_gene_variant ; 1496.0bp to feature; MODIFIER silent_mutation Average:63.017; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0706863183 A -> G LOC_Os07g12240-LOC_Os07g12250 intergenic_region ; MODIFIER silent_mutation Average:63.017; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0706863183 A G 0.05 0.05 0.03 0.03 0.06 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706863183 1.11E-06 1.11E-06 mr1994 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251