Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706614349:

Variant ID: vg0706614349 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6614349
Reference Allele: T	Alternative Allele: A,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGTCTAATATCACCATTCGAGATATTTACGAGAGATCACCATTATAATTTTGCTGAAACATGAGGTTTATTATCCATTTTGTTTACAGTGAGACTATC[T/A,C]
ACTTTCAATGCTAGAATAAACTACTCAAAGCAACGAGTTTGTCAGCAAGAACAACCTCAATGTCTTGGAGCATTCCTTAAGTACGACATCACATAATTTT

Reverse complement sequence

AAAATTATGTGATGTCGTACTTAAGGAATGCTCCAAGACATTGAGGTTGTTCTTGCTGACAAACTCGTTGCTTTGAGTAGTTTATTCTAGCATTGAAAGT[A/T,G]
GATAGTCTCACTGTAAACAAAATGGATAATAAACCTCATGTTTCAGCAAAATTATAATGGTGATCTCTCGTAAATATCTCGAATGGTGATATTAGACTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	0.40%	15.23%	44.77%	C: 0.04%
All Indica	2759	10.10%	0.70%	17.72%	71.40%	C: 0.07%
All Japonica	1512	93.10%	0.00%	0.20%	6.68%	NA
Aus	269	13.00%	0.70%	78.44%	7.81%	NA
Indica I	595	13.60%	0.70%	19.50%	65.88%	C: 0.34%
Indica II	465	13.80%	0.40%	4.73%	81.08%	NA
Indica III	913	3.80%	0.50%	20.26%	75.36%	NA
Indica Intermediate	786	12.60%	1.00%	21.12%	65.27%	NA
Temperate Japonica	767	87.70%	0.00%	0.26%	11.99%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	97.10%	0.00%	0.41%	2.49%	NA
VI/Aromatic	96	93.80%	0.00%	5.21%	1.04%	NA
Intermediate	90	61.10%	0.00%	13.33%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706614349	T -> DEL	N	N	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> A	LOC_Os07g11900.1	upstream_gene_variant ; 4660.0bp to feature; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> A	LOC_Os07g11910.1	upstream_gene_variant ; 2591.0bp to feature; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> A	LOC_Os07g11920.1	upstream_gene_variant ; 587.0bp to feature; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> A	LOC_Os07g11920-LOC_Os07g11970	intergenic_region ; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> C	LOC_Os07g11900.1	upstream_gene_variant ; 4660.0bp to feature; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> C	LOC_Os07g11910.1	upstream_gene_variant ; 2591.0bp to feature; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> C	LOC_Os07g11920.1	upstream_gene_variant ; 587.0bp to feature; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N
vg0706614349	T -> C	LOC_Os07g11920-LOC_Os07g11970	intergenic_region ; MODIFIER	silent_mutation	Average:7.242; most accessible tissue: Callus, score: 28.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706614349	NA	3.77E-10	mr1715	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349	NA	4.34E-06	mr1721	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349	NA	3.65E-07	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349	NA	6.66E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349	NA	1.58E-09	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349	NA	1.00E-08	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251