| Variant ID: vg0706185604 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6185604 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 78. )
GATTAACCTCTCTTTTACATAAGTTGTCAACTAGGTTATTTCCCGATAATGAGATGTGGTAGATAGACCTTAATCATGACAAGGATGAAATGCATGGAGA[A/T]
AAAGCAATATGTATCACTTCTTATCTCCTACTTTTTGATAGGTTCATATATATGATTTCCATGTTATTGTTATATAAGTGTGAGACTAATGTTTACTTGA
TCAAGTAAACATTAGTCTCACACTTATATAACAATAACATGGAAATCATATATATGAACCTATCAAAAAGTAGGAGATAAGAAGTGATACATATTGCTTT[T/A]
TCTCCATGCATTTCATCCTTGTCATGATTAAGGTCTATCTACCACATCTCATTATCGGGAAATAACCTAGTTGACAACTTATGTAAAAGAGAGGTTAATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 14.60% | 0.42% | 5.35% | NA |
| All Indica | 2759 | 79.40% | 16.90% | 0.36% | 3.37% | NA |
| All Japonica | 1512 | 88.00% | 11.60% | 0.46% | 0.00% | NA |
| Aus | 269 | 28.30% | 13.00% | 0.74% | 57.99% | NA |
| Indica I | 595 | 78.00% | 19.80% | 0.17% | 2.02% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 72.40% | 23.70% | 0.77% | 3.18% | NA |
| Indica Intermediate | 786 | 76.70% | 16.40% | 0.25% | 6.62% | NA |
| Temperate Japonica | 767 | 91.40% | 8.10% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 82.50% | 16.90% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 77.80% | 17.80% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706185604 | A -> DEL | N | N | silent_mutation | Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0706185604 | A -> T | LOC_Os07g11230.1 | upstream_gene_variant ; 2038.0bp to feature; MODIFIER | silent_mutation | Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0706185604 | A -> T | LOC_Os07g11240.1 | upstream_gene_variant ; 1418.0bp to feature; MODIFIER | silent_mutation | Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0706185604 | A -> T | LOC_Os07g11230-LOC_Os07g11240 | intergenic_region ; MODIFIER | silent_mutation | Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706185604 | NA | 5.72E-07 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | NA | 1.58E-07 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | NA | 2.33E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | 2.09E-06 | 2.09E-06 | mr1200 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | NA | 9.18E-06 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | NA | 5.76E-06 | mr1220 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | 7.00E-06 | 7.00E-06 | mr1234 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | NA | 5.73E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | NA | 2.31E-07 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706185604 | NA | 1.69E-07 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/