Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706130875:

Variant ID: vg0706130875 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6130875
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTAGGTCGATAGTGTGAATGGATTATGGGGTGTGCTCTGGGGTGTGGCAAAATTGGCGTGTTCCATCTTTTGGATATTGGTTGTTTCGGATAGACCTG[T/C]
TAGTTTTTCCTTCTTTTTTTTTCGAACTTTGGGTGTCTGAATATTTTTATTTAGGTAGATTTTTTTTGGAAAACATGTCGAAAACATTTGACGTGTAGAA

Reverse complement sequence

TTCTACACGTCAAATGTTTTCGACATGTTTTCCAAAAAAAATCTACCTAAATAAAAATATTCAGACACCCAAAGTTCGAAAAAAAAAGAAGGAAAAACTA[A/G]
CAGGTCTATCCGAAACAACCAATATCCAAAAGATGGAACACGCCAATTTTGCCACACCCCAGAGCACACCCCATAATCCATTCACACTATCGACCTAAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 7.50% 0.17% 0.00% NA
All Indica  2759 88.40% 11.30% 0.29% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 87.40% 12.60% 0.00% 0.00% NA
Indica I  595 79.70% 19.70% 0.67% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 90.00% 10.00% 0.00% 0.00% NA
Indica Intermediate  786 86.30% 13.20% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706130875 T -> C LOC_Os07g11110.1 upstream_gene_variant ; 3140.0bp to feature; MODIFIER silent_mutation Average:87.986; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0706130875 T -> C LOC_Os07g11080.1 downstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:87.986; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0706130875 T -> C LOC_Os07g11090.1 downstream_gene_variant ; 1289.0bp to feature; MODIFIER silent_mutation Average:87.986; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0706130875 T -> C LOC_Os07g11100.1 downstream_gene_variant ; 2042.0bp to feature; MODIFIER silent_mutation Average:87.986; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0706130875 T -> C LOC_Os07g11090-LOC_Os07g11100 intergenic_region ; MODIFIER silent_mutation Average:87.986; most accessible tissue: Minghui63 root, score: 95.261 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0706130875 T C 0.0 0.01 0.01 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706130875 NA 2.62E-08 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 8.03E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 4.13E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 3.11E-10 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 9.42E-06 NA mr1220 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 7.46E-08 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 1.94E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 4.27E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 1.85E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 3.72E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 2.28E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 6.50E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 4.07E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 2.96E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 1.03E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 1.66E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 8.58E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 3.62E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 7.36E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706130875 NA 7.65E-09 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251