Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705751437:

Variant ID: vg0705751437 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5751437
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.07, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAATCGTATGCTACCTGAAATGTGGTTCTGGGAGCTCATTCTGAGATAGGCTTGCGAACCAAAAAGAAGTACATCGGCGTGAAGATTTCCTTCCTGTA[G/T]
TTAATATATTTGCATTAGAACTTTGCATGAAGTATTAAACAGGAGAGGAAATGGAAAAACAGACAGCTGAACTGGAATTCCAGAATTCGTGACAATTATG

Reverse complement sequence

CATAATTGTCACGAATTCTGGAATTCCAGTTCAGCTGTCTGTTTTTCCATTTCCTCTCCTGTTTAATACTTCATGCAAAGTTCTAATGCAAATATATTAA[C/A]
TACAGGAAGGAAATCTTCACGCCGATGTACTTCTTTTTGGTTCGCAAGCCTATCTCAGAATGAGCTCCCAGAACCACATTTCAGGTAGCATACGATTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 27.50% 0.06% 0.00% NA
All Indica  2759 61.80% 38.10% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 13.40% 86.60% 0.00% 0.00% NA
Indica I  595 80.30% 19.70% 0.00% 0.00% NA
Indica II  465 81.50% 18.50% 0.00% 0.00% NA
Indica III  913 38.10% 61.80% 0.11% 0.00% NA
Indica Intermediate  786 63.60% 36.30% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705751437 G -> T LOC_Os07g10600.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:59.254; most accessible tissue: Zhenshan97 flower, score: 81.984 N N N N
vg0705751437 G -> T LOC_Os07g10600.2 splice_region_variant&intron_variant ; LOW silent_mutation Average:59.254; most accessible tissue: Zhenshan97 flower, score: 81.984 N N N N
vg0705751437 G -> T LOC_Os07g10590.1 upstream_gene_variant ; 1611.0bp to feature; MODIFIER silent_mutation Average:59.254; most accessible tissue: Zhenshan97 flower, score: 81.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705751437 NA 1.21E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0705751437 NA 9.65E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.06E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 2.67E-06 2.44E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 7.35E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.27E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 1.77E-07 2.31E-14 mr1213 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 1.82E-06 3.15E-08 mr1246 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 9.93E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 3.32E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 4.50E-06 1.87E-07 mr1620 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 4.03E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 7.68E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 8.33E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 2.61E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 6.12E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.95E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.54E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.25E-06 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.05E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.46E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 5.59E-09 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705751437 NA 1.72E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251