Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705110338:

Variant ID: vg0705110338 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5110338
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGCAGGAAGAAGGCACTGTAGCTTCATACTACTAGTTCAAAATTTTAGTCTTAAATTTTTTTTCCCGATTACATGTCACTGCACACGCAACACAATGG[C/T]
CTTGTTTGGATCCTTCGGGCTATTAAATAGCCCTCAAGAATCTTACTATTTAGGATTATTAAACGTATATTACCGACAAAACCGATTCCATAACCCCTAG

Reverse complement sequence

CTAGGGGTTATGGAATCGGTTTTGTCGGTAATATACGTTTAATAATCCTAAATAGTAAGATTCTTGAGGGCTATTTAATAGCCCGAAGGATCCAAACAAG[G/A]
CCATTGTGTTGCGTGTGCAGTGACATGTAATCGGGAAAAAAAATTTAAGACTAAAATTTTGAACTAGTAGTATGAAGCTACAGTGCCTTCTTCCTGCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 10.70% 0.17% 0.57% NA
All Indica  2759 90.20% 8.60% 0.25% 0.98% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 3.70% 96.30% 0.00% 0.00% NA
Indica I  595 84.50% 13.40% 0.84% 1.18% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 89.50% 9.10% 0.00% 1.42% NA
Indica Intermediate  786 89.90% 8.90% 0.25% 0.89% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705110338 C -> DEL N N silent_mutation Average:80.625; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N
vg0705110338 C -> T LOC_Os07g09620.1 upstream_gene_variant ; 651.0bp to feature; MODIFIER silent_mutation Average:80.625; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N
vg0705110338 C -> T LOC_Os07g09610.1 downstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:80.625; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N
vg0705110338 C -> T LOC_Os07g09625.1 downstream_gene_variant ; 3596.0bp to feature; MODIFIER silent_mutation Average:80.625; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N
vg0705110338 C -> T LOC_Os07g09620-LOC_Os07g09625 intergenic_region ; MODIFIER silent_mutation Average:80.625; most accessible tissue: Zhenshan97 panicle, score: 95.081 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0705110338 C T -0.04 -0.02 -0.02 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705110338 NA 1.80E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 2.50E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 9.32E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.53E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.73E-08 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 3.99E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 3.26E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.39E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 3.46E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 2.27E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.08E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.35E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 4.59E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.73E-06 mr1394 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 7.70E-10 mr1397 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 2.46E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 8.57E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 8.82E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 9.72E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 5.20E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 3.42E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 8.05E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 7.87E-08 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 5.27E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.85E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 9.64E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 8.39E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 4.10E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 7.04E-09 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 5.04E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 3.62E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 3.66E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 9.97E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.44E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 3.78E-08 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705110338 NA 1.45E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251