Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704635310:

Variant ID: vg0704635310 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4635310
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TTCATCGGACTTCGAAACCAGCTATCTCAGCTGAGATTACCAGGGGATCTTGATGCAGGAACATAACTCCTTCTGCGTCTTCCGGCCCAAAAGAAATTAG[T/C]
TGGTTCAGATACTGCGGCGCCCCTTCACCCGCCGAAGTGATGCTGTGGACCATACGGGTCTGCATCTTCTTCTGCCGTTTGGACAACTGGCTTGGCGGGT

Reverse complement sequence

ACCCGCCAAGCCAGTTGTCCAAACGGCAGAAGAAGATGCAGACCCGTATGGTCCACAGCATCACTTCGGCGGGTGAAGGGGCGCCGCAGTATCTGAACCA[A/G]
CTAATTTCTTTTGGGCCGGAAGACGCAGAAGGAGTTATGTTCCTGCATCAAGATCCCCTGGTAATCTCAGCTGAGATAGCTGGTTTCGAAGTCCGATGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.80%	24.30%	30.94%	0.02%	NA
All Indica	2759	38.80%	10.70%	50.45%	0.04%	NA
All Japonica	1512	64.20%	35.40%	0.40%	0.00%	NA
Aus	269	8.60%	75.10%	16.36%	0.00%	NA
Indica I	595	23.40%	7.70%	68.91%	0.00%	NA
Indica II	465	36.80%	11.40%	51.83%	0.00%	NA
Indica III	913	50.20%	12.20%	37.68%	0.00%	NA
Indica Intermediate	786	38.40%	10.90%	50.51%	0.13%	NA
Temperate Japonica	767	56.50%	43.00%	0.52%	0.00%	NA
Tropical Japonica	504	75.00%	24.80%	0.20%	0.00%	NA
Japonica Intermediate	241	66.00%	33.60%	0.41%	0.00%	NA
VI/Aromatic	96	15.60%	83.30%	1.04%	0.00%	NA
Intermediate	90	42.20%	36.70%	21.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704635310	T -> DEL	N	N	silent_mutation	Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0704635310	T -> C	LOC_Os07g08910.1	upstream_gene_variant ; 564.0bp to feature; MODIFIER	silent_mutation	Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0704635310	T -> C	LOC_Os07g08900.1	downstream_gene_variant ; 4351.0bp to feature; MODIFIER	silent_mutation	Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0704635310	T -> C	LOC_Os07g08920.1	downstream_gene_variant ; 468.0bp to feature; MODIFIER	silent_mutation	Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0704635310	T -> C	LOC_Os07g08910-LOC_Os07g08920	intergenic_region ; MODIFIER	silent_mutation	Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704635310	1.53E-07	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	NA	1.56E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	2.19E-07	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	3.04E-06	2.31E-08	mr1309	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	2.60E-09	NA	mr1484	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	NA	5.22E-07	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	NA	2.24E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	NA	1.29E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310	1.77E-06	NA	mr1945	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251