Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703938539:

Variant ID: vg0703938539 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 3938539
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGCAACTGGATCATACCTCACCCACTTCTTGTGGGAGAAGGTCGTAATAGCCCATTGGGCAACATATGAGATGGGTTGGCCAGATTTTCAAGCTAGC[T/C]
AGTATAAGGAGGTGGGCCAAGTAGAAATTGGCCTATTAAAAGGAGTCGGGCACGAACCGTGATTTTGGTCCGAAAACGGCATTTTATTTCAACAGTCCTT

Reverse complement sequence

AAGGACTGTTGAAATAAAATGCCGTTTTCGGACCAAAATCACGGTTCGTGCCCGACTCCTTTTAATAGGCCAATTTCTACTTGGCCCACCTCCTTATACT[A/G]
GCTAGCTTGAAAATCTGGCCAACCCATCTCATATGTTGCCCAATGGGCTATTACGACCTTCTCCCACAAGAAGTGGGTGAGGTATGATCCAGTTGCCATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.50%	1.70%	8.63%	59.18%	NA
All Indica	2759	9.00%	1.40%	5.55%	84.02%	NA
All Japonica	1512	72.70%	1.20%	7.80%	18.32%	NA
Aus	269	7.40%	3.00%	27.14%	62.45%	NA
Indica I	595	7.60%	1.70%	6.72%	84.03%	NA
Indica II	465	10.30%	0.60%	3.23%	85.81%	NA
Indica III	913	7.20%	1.00%	6.24%	85.54%	NA
Indica Intermediate	786	11.30%	2.30%	5.22%	81.17%	NA
Temperate Japonica	767	60.60%	2.00%	10.30%	27.12%	NA
Tropical Japonica	504	87.10%	0.00%	5.36%	7.54%	NA
Japonica Intermediate	241	80.90%	1.20%	4.98%	12.86%	NA
VI/Aromatic	96	24.00%	14.60%	58.33%	3.12%	NA
Intermediate	90	55.60%	1.10%	8.89%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0703938539	T -> DEL	N	N	silent_mutation	Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0703938539	T -> C	LOC_Os07g07840.1	upstream_gene_variant ; 1679.0bp to feature; MODIFIER	silent_mutation	Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0703938539	T -> C	LOC_Os07g07850.1	upstream_gene_variant ; 321.0bp to feature; MODIFIER	silent_mutation	Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0703938539	T -> C	LOC_Os07g07830.1	downstream_gene_variant ; 4748.0bp to feature; MODIFIER	silent_mutation	Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0703938539	T -> C	LOC_Os07g07850-LOC_Os07g07860	intergenic_region ; MODIFIER	silent_mutation	Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0703938539	8.04E-06	NA	mr1089	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539	2.56E-06	NA	mr1089	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539	NA	3.45E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539	NA	3.65E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539	NA	2.39E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539	NA	8.93E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539	NA	2.28E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539	NA	2.72E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251