Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703879153:

Variant ID: vg0703879153 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 3879153
Reference Allele: CT	Alternative Allele: GT,C
Primary Allele: GT	Secondary Allele: CT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAAGAGAACAAAGACAGAAAGGTGCATAAAAGAAAAAGAAAAGCCGCACAAAAAAGAAAATAAAGAAAAACAACAACAACAAAAGTTTTTTTTCCTTA[CT/GT,C]
GGCGAAAAAAACTGTAGATCCGACGGAAAAAAGATTTGATTCATATAAAAGGCAAAAAAAAAAAGTGGTGACAAAAAAAACGCTAGATCCGAATCCTTTA

Reverse complement sequence

TAAAGGATTCGGATCTAGCGTTTTTTTTGTCACCACTTTTTTTTTTTGCCTTTTATATGAATCAAATCTTTTTTCCGTCGGATCTACAGTTTTTTTCGCC[AG/AC,G]
TAAGGAAAAAAAACTTTTGTTGTTGTTGTTTTTCTTTATTTTCTTTTTTGTGCGGCTTTTCTTTTTCTTTTATGCACCTTTCTGTCTTTGTTCTCTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of CT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	12.30%	1.88%	1.10%	C: 0.06%
All Indica	2759	93.50%	2.20%	2.61%	1.59%	C: 0.04%
All Japonica	1512	65.70%	33.20%	0.46%	0.46%	C: 0.13%
Aus	269	97.00%	0.40%	2.23%	0.37%	NA
Indica I	595	92.90%	3.90%	0.84%	2.35%	NA
Indica II	465	93.80%	3.00%	1.51%	1.51%	C: 0.22%
Indica III	913	93.20%	0.20%	5.37%	1.20%	NA
Indica Intermediate	786	94.30%	2.80%	1.40%	1.53%	NA
Temperate Japonica	767	46.40%	52.20%	0.78%	0.65%	NA
Tropical Japonica	504	91.70%	7.50%	0.20%	0.20%	C: 0.40%
Japonica Intermediate	241	73.00%	26.60%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	20.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0703879153	CT -> DEL	N	N	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> GT	LOC_Os07g07715.1	upstream_gene_variant ; 1643.0bp to feature; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> GT	LOC_Os07g07719.1	upstream_gene_variant ; 4388.0bp to feature; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> GT	LOC_Os07g07709.1	downstream_gene_variant ; 4076.0bp to feature; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> GT	LOC_Os07g07709-LOC_Os07g07715	intergenic_region ; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> C	LOC_Os07g07715.1	upstream_gene_variant ; 1642.0bp to feature; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> C	LOC_Os07g07719.1	upstream_gene_variant ; 4387.0bp to feature; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> C	LOC_Os07g07709.1	downstream_gene_variant ; 4077.0bp to feature; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N
vg0703879153	CT -> C	LOC_Os07g07709-LOC_Os07g07715	intergenic_region ; MODIFIER	silent_mutation	Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0703879153	NA	1.84E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0703879153	NA	3.71E-07	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	6.90E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	2.18E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	2.64E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	1.97E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	2.54E-09	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	9.44E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	5.29E-09	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	5.60E-08	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	9.58E-09	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	3.05E-06	3.04E-06	mr1494	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	3.02E-09	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	8.12E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	3.65E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	6.46E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	5.88E-06	mr1604	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	2.33E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	4.96E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	8.41E-06	mr1654	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	1.60E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	9.09E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	3.00E-09	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	3.54E-07	mr1748	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	4.23E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	5.86E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	2.51E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	4.53E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	1.23E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	1.22E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153	NA	2.04E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251