Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703855509:

Variant ID: vg0703855509 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 3855509
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

ATCATATAAATATCGTTTTTTTTTGACAAATTGATTCGAAAACTTATTTCAAAATTAGAACATGCAAAAAAAAAAGAAAAAAAAACTCCAAGGCGGTTGG[C/T]
GCGTCGAGACTACATCCTTTTTGTTTGAAGTTTTTTCGTGCTTTAGTCTCGAAATAAGTTTTCAAAAAGGACCAATCTATCAAAAAGAAAAGGATAAAAC

Reverse complement sequence

GTTTTATCCTTTTCTTTTTGATAGATTGGTCCTTTTTGAAAACTTATTTCGAGACTAAAGCACGAAAAAACTTCAAACAAAAAGGATGTAGTCTCGACGC[G/A]
CCAACCGCCTTGGAGTTTTTTTTTCTTTTTTTTTTGCATGTTCTAATTTTGAAATAAGTTTTCGAATCAATTTGTCAAAAAAAAACGATATTTATATGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	37.20%	1.33%	0.00%	NA
All Indica	2759	60.70%	38.10%	1.27%	0.00%	NA
All Japonica	1512	64.00%	34.20%	1.79%	0.00%	NA
Aus	269	40.90%	59.10%	0.00%	0.00%	NA
Indica I	595	68.10%	29.40%	2.52%	0.00%	NA
Indica II	465	68.40%	29.50%	2.15%	0.00%	NA
Indica III	913	48.50%	51.50%	0.00%	0.00%	NA
Indica Intermediate	786	64.60%	34.10%	1.27%	0.00%	NA
Temperate Japonica	767	42.90%	54.10%	3.00%	0.00%	NA
Tropical Japonica	504	90.90%	8.90%	0.20%	0.00%	NA
Japonica Intermediate	241	75.10%	23.70%	1.24%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0703855509	C -> T	LOC_Os07g07690.1	upstream_gene_variant ; 4246.0bp to feature; MODIFIER	silent_mutation	Average:43.792; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N
vg0703855509	C -> T	LOC_Os07g07690.2	upstream_gene_variant ; 4246.0bp to feature; MODIFIER	silent_mutation	Average:43.792; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N
vg0703855509	C -> T	LOC_Os07g07680-LOC_Os07g07690	intergenic_region ; MODIFIER	silent_mutation	Average:43.792; most accessible tissue: Zhenshan97 flower, score: 74.205	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0703855509	NA	9.92E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0703855509	NA	7.66E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703855509	NA	4.45E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703855509	NA	4.08E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703855509	NA	2.62E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703855509	NA	7.64E-06	mr1742	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703855509	NA	7.73E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251