Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703336669:

Variant ID: vg0703336669 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3336669
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATGAAAATATTTATGTCATGCTTAAAGAACATTTGATGATGAATCAAGTCAAAATAAAATAAATGATAACTATATAAATTTTTTGAATAAAATGAATG[A/G]
TCAAACACTAGATAAAAAGTCAATGACGTCATACATTAAAATATGGAGGTAGTAATATTGAAGTTCTAGATTTTATTAGGTGTCGTAGGCCCCAAAAAAA

Reverse complement sequence

TTTTTTTGGGGCCTACGACACCTAATAAAATCTAGAACTTCAATATTACTACCTCCATATTTTAATGTATGACGTCATTGACTTTTTATCTAGTGTTTGA[T/C]
CATTCATTTTATTCAAAAAATTTATATAGTTATCATTTATTTTATTTTGACTTGATTCATCATCAAATGTTCTTTAAGCATGACATAAATATTTTCATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.30% 0.19% 0.00% NA
All Indica  2759 92.20% 7.60% 0.22% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 79.60% 20.40% 0.00% 0.00% NA
Indica I  595 90.30% 9.20% 0.50% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 92.20% 7.60% 0.22% 0.00% NA
Indica Intermediate  786 89.90% 10.10% 0.00% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 46.70% 51.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703336669 A -> G LOC_Os07g06830.1 upstream_gene_variant ; 2394.0bp to feature; MODIFIER silent_mutation Average:41.15; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0703336669 A -> G LOC_Os07g06834.1 upstream_gene_variant ; 2715.0bp to feature; MODIFIER silent_mutation Average:41.15; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0703336669 A -> G LOC_Os07g06830-LOC_Os07g06834 intergenic_region ; MODIFIER silent_mutation Average:41.15; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703336669 4.84E-09 3.29E-08 Awn_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0703336669 NA 1.12E-26 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 2.44E-09 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 1.40E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 3.10E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 4.48E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 9.55E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 2.20E-42 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 7.40E-09 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 2.45E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 6.97E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 4.93E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 7.17E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 1.49E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 7.38E-06 mr1511_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 5.85E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 7.43E-06 mr1681_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 2.16E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 1.19E-07 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 5.60E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 1.58E-06 mr1944_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336669 NA 8.83E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251