| Variant ID: vg0702641922 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2641922 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.08, others allele: 0.00, population size: 259. )
CATGGAAACGACAAGGACTACTCGGATTGTATCCATATTGGTTTCCCTAATTCTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGGCCCCCTAG[G/A]
AGGAGAGGGGAGACACCCACCATGGAAGCCACCCACAATCAACATACACGGAACAATAGGTCAAGACAGAAGATCAACATACAAGCTAACATACGCCAAG
CTTGGCGTATGTTAGCTTGTATGTTGATCTTCTGTCTTGACCTATTGTTCCGTGTATGTTGATTGTGGGTGGCTTCCATGGTGGGTGTCTCCCCTCTCCT[C/T]
CTAGGGGGCCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAATTAGGGAAACCAATATGGATACAATCCGAGTAGTCCTTGTCGTTTCCATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 38.80% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 91.90% | 7.70% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.50% | 19.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 7.40% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 99.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 54.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702641922 | G -> A | LOC_Os07g05610.1 | upstream_gene_variant ; 1432.0bp to feature; MODIFIER | silent_mutation | Average:62.78; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0702641922 | G -> A | LOC_Os07g05610.2 | upstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:62.78; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0702641922 | G -> A | LOC_Os07g05610.3 | upstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:62.78; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0702641922 | G -> A | LOC_Os07g05610.4 | upstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:62.78; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0702641922 | G -> A | LOC_Os07g05620.1 | downstream_gene_variant ; 1618.0bp to feature; MODIFIER | silent_mutation | Average:62.78; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0702641922 | G -> A | LOC_Os07g05620.2 | downstream_gene_variant ; 1618.0bp to feature; MODIFIER | silent_mutation | Average:62.78; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| vg0702641922 | G -> A | LOC_Os07g05610-LOC_Os07g05620 | intergenic_region ; MODIFIER | silent_mutation | Average:62.78; most accessible tissue: Zhenshan97 root, score: 80.909 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702641922 | NA | 2.11E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | NA | 3.95E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | NA | 1.54E-36 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | NA | 3.10E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | NA | 7.09E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | NA | 1.14E-18 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | NA | 4.07E-29 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | 7.03E-06 | 1.97E-27 | mr1708_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | 4.87E-06 | 1.27E-06 | mr1708_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702641922 | NA | 6.79E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |