Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702621393:

Variant ID: vg0702621393 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2621393
Reference Allele: TAlternative Allele: A,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.08, A: 0.06, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGACGCGAGAGAGAGAGAGGAGAGATCAACAAGGCTGGTGTATAGTACTCCCTCCATTTTTAATGTATGACGTCGTTGACTTTTTATCCAACGTTTAA[T/A,C]
CATTTATCTTATTCAAAAAATTTATGTAACTATCATTTATTTTATTGTGACTTGATTCATCATTAAATATTCTTTAAGCATGACATAAATATTCTCATAT

Reverse complement sequence

ATATGAGAATATTTATGTCATGCTTAAAGAATATTTAATGATGAATCAAGTCACAATAAAATAAATGATAGTTACATAAATTTTTTGAATAAGATAAATG[A/T,G]
TTAAACGTTGGATAAAAAGTCAACGACGTCATACATTAAAAATGGAGGGAGTACTATACACCAGCCTTGTTGATCTCTCCTCTCTCTCTCTCGCGTCGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 38.60% 0.51% 0.00% C: 6.03%
All Indica  2759 90.00% 7.40% 0.51% 0.00% C: 2.03%
All Japonica  1512 0.90% 99.10% 0.07% 0.00% NA
Aus  269 14.50% 1.90% 1.86% 0.00% C: 81.78%
Indica I  595 80.80% 19.00% 0.17% 0.00% NA
Indica II  465 96.30% 3.00% 0.43% 0.00% C: 0.22%
Indica III  913 93.20% 3.10% 0.33% 0.00% C: 3.40%
Indica Intermediate  786 89.60% 6.40% 1.02% 0.00% C: 3.05%
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.20% 0.20% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 72.90% 0.00% 0.00% C: 3.12%
Intermediate  90 35.60% 53.30% 4.44% 0.00% C: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702621393 T -> A LOC_Os07g05590.1 downstream_gene_variant ; 1897.0bp to feature; MODIFIER silent_mutation Average:48.846; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0702621393 T -> A LOC_Os07g05580-LOC_Os07g05590 intergenic_region ; MODIFIER silent_mutation Average:48.846; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0702621393 T -> C LOC_Os07g05590.1 downstream_gene_variant ; 1897.0bp to feature; MODIFIER silent_mutation Average:48.846; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0702621393 T -> C LOC_Os07g05580-LOC_Os07g05590 intergenic_region ; MODIFIER silent_mutation Average:48.846; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702621393 NA 5.62E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 9.97E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 7.39E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.99E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 3.58E-36 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.66E-49 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.12E-37 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.43E-50 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 9.90E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.34E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 5.08E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 8.20E-27 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.14E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.51E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.31E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 4.17E-06 NA mr1339 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 7.76E-07 7.75E-07 mr1339 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.37E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.93E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.15E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 6.35E-44 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.86E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.71E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.11E-28 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.29E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.58E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 5.13E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.18E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.21E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.06E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 3.43E-60 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.40E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 6.09E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.25E-42 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 7.90E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.25E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 8.53E-33 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.09E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.42E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 7.76E-30 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.53E-50 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 5.63E-10 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 5.27E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.90E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.81E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.95E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.76E-17 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 2.02E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 5.71E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.18E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.09E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.04E-58 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 6.83E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 3.55E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 1.06E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.96E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 3.08E-47 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 4.11E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 NA 3.36E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702621393 5.23E-06 1.22E-09 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251