Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702475950:

Variant ID: vg0702475950 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2475950
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AATGTTTGGACACATACATAGAGTATTAAATATAAATAAAAAAAATAACTAATTACACAGATTGCGTGTAAATCGCGAGACGAATCTTTTAAGCCTAATT[A/G]
CGCCATGATTTGACAATGTGGTGCTACAGTAAACATTGTTGATGACGGATTAATTAGGTTCAATAAATTCGTCTCGCAGTTTACAGGCAGAATCTGTAAT

Reverse complement sequence

ATTACAGATTCTGCCTGTAAACTGCGAGACGAATTTATTGAACCTAATTAATCCGTCATCAACAATGTTTACTGTAGCACCACATTGTCAAATCATGGCG[T/C]
AATTAGGCTTAAAAGATTCGTCTCGCGATTTACACGCAATCTGTGTAATTAGTTATTTTTTTTATTTATATTTAATACTCTATGTATGTGTCCAAACATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	37.10%	0.02%	0.00%	NA
All Indica	2759	95.10%	4.90%	0.04%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	85.40%	14.60%	0.00%	0.00%	NA
Indica II	465	96.30%	3.40%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	3.70%	0.00%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702475950	A -> G	LOC_Os07g05390.1	upstream_gene_variant ; 1993.0bp to feature; MODIFIER	silent_mutation	Average:61.318; most accessible tissue: Callus, score: 72.341	N	N	N	N
vg0702475950	A -> G	LOC_Os07g05400.1	downstream_gene_variant ; 885.0bp to feature; MODIFIER	silent_mutation	Average:61.318; most accessible tissue: Callus, score: 72.341	N	N	N	N
vg0702475950	A -> G	LOC_Os07g05390-LOC_Os07g05400	intergenic_region ; MODIFIER	silent_mutation	Average:61.318; most accessible tissue: Callus, score: 72.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702475950	NA	6.81E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	5.50E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	2.59E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	8.03E-07	8.03E-07	mr1412	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	1.34E-87	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	7.63E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	3.47E-38	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	3.20E-45	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	6.82E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	1.51E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	2.57E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	3.37E-31	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	1.03E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	5.41E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	4.75E-88	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	6.77E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	1.54E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	7.61E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	7.47E-06	mr1804	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702475950	NA	5.93E-19	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251