Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701665457:

Variant ID: vg0701665457 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1665457
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTCAACCCTCACGTGCATTACCATATCCCACCTACTACACATATCTAACTTGAATACAAATGCTTTTTTTTACTAATCCTGGAGACATCTTTAGTACC[G/A]
GAATATTTTTAGTCCAAATTAGTGTTATCAACCGGTACTAAAAATACATCTTTAGTACCAGTTGATAATACCAACCCGGACTAAAGATCCTCTAGCTTTA

Reverse complement sequence

TAAAGCTAGAGGATCTTTAGTCCGGGTTGGTATTATCAACTGGTACTAAAGATGTATTTTTAGTACCGGTTGATAACACTAATTTGGACTAAAAATATTC[C/T]
GGTACTAAAGATGTCTCCAGGATTAGTAAAAAAAAGCATTTGTATTCAAGTTAGATATGTGTAGTAGGTGGGATATGGTAATGCACGTGAGGGTTGAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.60%	14.70%	0.15%	58.57%	NA
All Indica	2759	43.00%	12.50%	0.04%	44.44%	NA
All Japonica	1512	1.70%	9.00%	0.13%	89.22%	NA
Aus	269	3.30%	62.80%	0.74%	33.09%	NA
Indica I	595	33.60%	29.20%	0.00%	37.14%	NA
Indica II	465	43.20%	2.20%	0.22%	54.41%	NA
Indica III	913	48.30%	8.70%	0.00%	43.04%	NA
Indica Intermediate	786	43.90%	10.40%	0.00%	45.67%	NA
Temperate Japonica	767	1.00%	15.30%	0.26%	83.44%	NA
Tropical Japonica	504	2.40%	2.40%	0.00%	95.24%	NA
Japonica Intermediate	241	2.10%	2.90%	0.00%	95.02%	NA
VI/Aromatic	96	3.10%	33.30%	2.08%	61.46%	NA
Intermediate	90	34.40%	15.60%	0.00%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701665457	G -> DEL	N	N	silent_mutation	Average:10.843; most accessible tissue: Callus, score: 53.57	N	N	N	N
vg0701665457	G -> A	LOC_Os07g03960.1	upstream_gene_variant ; 3853.0bp to feature; MODIFIER	silent_mutation	Average:10.843; most accessible tissue: Callus, score: 53.57	N	N	N	N
vg0701665457	G -> A	LOC_Os07g03940.1	downstream_gene_variant ; 3190.0bp to feature; MODIFIER	silent_mutation	Average:10.843; most accessible tissue: Callus, score: 53.57	N	N	N	N
vg0701665457	G -> A	LOC_Os07g03950.1	downstream_gene_variant ; 635.0bp to feature; MODIFIER	silent_mutation	Average:10.843; most accessible tissue: Callus, score: 53.57	N	N	N	N
vg0701665457	G -> A	LOC_Os07g03940-LOC_Os07g03950	intergenic_region ; MODIFIER	silent_mutation	Average:10.843; most accessible tissue: Callus, score: 53.57	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701665457	NA	3.02E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	NA	3.95E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	6.30E-07	4.10E-07	mr1263	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	NA	6.65E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	6.30E-07	4.10E-07	mr1451	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	NA	2.17E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	NA	8.43E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	NA	5.53E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457	NA	1.03E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251