Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701481335:

Variant ID: vg0701481335 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1481335
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAATTCAAAATTTTAATTGATAAAAAAAGTCACAATAAAAAATGGCCAAAATAATAGCAGTAAGAACACAATAACATGATAGAGCATGATTTTAGAAA[T/C]
ATTTAGAAAAAAGAATCATCTAATTTAGAGTTCATATAAGTGAGATACACTAGTTTCAAATTTTATTTTTGCATACGGCTCCTTAAGTAGCCCGTATGGA

Reverse complement sequence

TCCATACGGGCTACTTAAGGAGCCGTATGCAAAAATAAAATTTGAAACTAGTGTATCTCACTTATATGAACTCTAAATTAGATGATTCTTTTTTCTAAAT[A/G]
TTTCTAAAATCATGCTCTATCATGTTATTGTGTTCTTACTGCTATTATTTTGGCCATTTTTTATTGTGACTTTTTTTATCAATTAAAATTTTGAATTTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.70%	35.00%	6.92%	12.42%	NA
All Indica	2759	67.70%	21.80%	5.40%	5.04%	NA
All Japonica	1512	4.30%	58.20%	8.27%	29.23%	NA
Aus	269	39.00%	44.60%	15.24%	1.12%	NA
Indica I	595	92.90%	6.10%	0.67%	0.34%	NA
Indica II	465	15.70%	45.60%	16.99%	21.72%	NA
Indica III	913	81.70%	16.00%	1.97%	0.33%	NA
Indica Intermediate	786	63.20%	26.50%	6.11%	4.20%	NA
Temperate Japonica	767	1.70%	79.90%	4.82%	13.56%	NA
Tropical Japonica	504	8.30%	29.00%	12.50%	50.20%	NA
Japonica Intermediate	241	4.10%	50.20%	10.37%	35.27%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	41.10%	43.30%	12.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701481335	T -> DEL	N	N	silent_mutation	Average:13.881; most accessible tissue: Callus, score: 24.617	N	N	N	N
vg0701481335	T -> C	LOC_Os07g03650.1	upstream_gene_variant ; 3136.0bp to feature; MODIFIER	silent_mutation	Average:13.881; most accessible tissue: Callus, score: 24.617	N	N	N	N
vg0701481335	T -> C	LOC_Os07g03670.1	upstream_gene_variant ; 4319.0bp to feature; MODIFIER	silent_mutation	Average:13.881; most accessible tissue: Callus, score: 24.617	N	N	N	N
vg0701481335	T -> C	LOC_Os07g03640.1	downstream_gene_variant ; 4618.0bp to feature; MODIFIER	silent_mutation	Average:13.881; most accessible tissue: Callus, score: 24.617	N	N	N	N
vg0701481335	T -> C	LOC_Os07g03650-LOC_Os07g03670	intergenic_region ; MODIFIER	silent_mutation	Average:13.881; most accessible tissue: Callus, score: 24.617	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701481335	NA	7.09E-06	mr1050	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335	NA	4.77E-06	mr1272	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335	NA	9.00E-06	mr1786	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335	1.73E-06	1.53E-06	mr1797	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335	1.73E-06	1.53E-06	mr1801	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251