Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701136340:

Variant ID: vg0701136340 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1136340
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGGGGAATGAAAAGTGTCAATTTTGTGATAAAAAAGAGGATATACAGCACTTGTTTTTTGAATGCCCTTTGGCCAAACTTCTCTGGAATATCATGTGT[T/A]
GTGCTTTGGATATACTGCCTACTTTGAATCATCAGGATATTTTTGGACATTGGCTGGATAGACATGATAAAAACATGAAACACTTGATTGTGATTGGTTT

Reverse complement sequence

AAACCAATCACAATCAAGTGTTTCATGTTTTTATCATGTCTATCCAGCCAATGTCCAAAAATATCCTGATGATTCAAAGTAGGCAGTATATCCAAAGCAC[A/T]
ACACATGATATTCCAGAGAAGTTTGGCCAAAGGGCATTCAAAAAACAAGTGCTGTATATCCTCTTTTTTATCACAAAATTGACACTTTTCATTCCCCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 4.00% 0.57% 0.40% NA
All Indica  2759 99.10% 0.90% 0.04% 0.00% NA
All Japonica  1512 97.60% 0.00% 1.12% 1.26% NA
Aus  269 37.50% 59.90% 2.60% 0.00% NA
Indica I  595 98.70% 1.20% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.00% 0.13% 0.52% NA
Tropical Japonica  504 94.00% 0.00% 3.17% 2.78% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701136340 T -> DEL N N silent_mutation Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0701136340 T -> A LOC_Os07g03020.1 downstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0701136340 T -> A LOC_Os07g03025.1 downstream_gene_variant ; 3722.0bp to feature; MODIFIER silent_mutation Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0701136340 T -> A LOC_Os07g03020-LOC_Os07g03025 intergenic_region ; MODIFIER silent_mutation Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701136340 NA 7.04E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 2.59E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 2.73E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 3.75E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 9.68E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 4.15E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 1.90E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 3.18E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 8.88E-10 mr1320 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 8.31E-07 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 3.22E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 1.78E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 3.22E-13 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 4.37E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 8.35E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 9.15E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 2.63E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 2.22E-08 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 2.54E-41 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 1.53E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 2.42E-13 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 1.58E-36 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 9.01E-11 mr1762 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 5.81E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 9.50E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340 NA 5.46E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251