Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700250116:

Variant ID: vg0700250116 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 250116
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAGTCATCTGTGACGGGCTATAGTTTAGGCCCGATTGAGATGTGTATCATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAGTAGTCATCTGT[G/A]
ACGGGCGCTAGTTGTGGCCCGATAGAGATAGGTCATCTGTAACGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCTATCTGTGACGAGCTTTACTTAG

Reverse complement sequence

CTAAGTAAAGCTCGTCACAGATAGCTTTGACCCAGACGACCAGTCAAACTATAGCCCGTTACAGATGACCTATCTCTATCGGGCCACAACTAGCGCCCGT[C/T]
ACAGATGACTACTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATGATACACATCTCAATCGGGCCTAAACTATAGCCCGTCACAGATGACTACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	46.50%	0.11%	0.00%	NA
All Indica	2759	31.30%	68.50%	0.18%	0.00%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	13.00%	87.00%	0.00%	0.00%	NA
Indica I	595	56.60%	43.20%	0.17%	0.00%	NA
Indica II	465	51.40%	48.60%	0.00%	0.00%	NA
Indica III	913	8.40%	91.50%	0.11%	0.00%	NA
Indica Intermediate	786	26.80%	72.80%	0.38%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700250116	G -> A	LOC_Os07g01400.1	upstream_gene_variant ; 2702.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700250116	G -> A	LOC_Os07g01390.1	downstream_gene_variant ; 1494.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700250116	G -> A	LOC_Os07g01390-LOC_Os07g01400	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700250116	NA	2.87E-07	mr1158	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116	NA	3.07E-06	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116	2.52E-06	3.87E-09	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116	NA	8.63E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116	6.89E-06	NA	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116	5.22E-07	1.28E-09	mr1383	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116	NA	8.32E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700250116	NA	1.60E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251