Variant ID: vg0700065801 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 65801 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )
GGTGACTGACAGGGGCACCCCCCGTGTCAGGCGGCAAGATTTGATAGGCCTCATCATCAAGATGACGTGCGCTTGCTTCCCAAGTCAAGAGACAAGACAT[G/A]
CATTTAATGCAAAGATTGTAATCCTTCTCCACTAAGTTATGTTTTTAGGCCCATGTGGTAACCCCTTGAGATATAAAAGGAGGTCCAGGCCTAGTAGGAG
CTCCTACTAGGCCTGGACCTCCTTTTATATCTCAAGGGGTTACCACATGGGCCTAAAAACATAACTTAGTGGAGAAGGATTACAATCTTTGCATTAAATG[C/T]
ATGTCTTGTCTCTTGACTTGGGAAGCAAGCGCACGTCATCTTGATGATGAGGCCTATCAAATCTTGCCGCCTGACACGGGGGGTGCCCCTGTCAGTCACC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
All Indica | 2759 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 51.40% | 48.60% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0700065801 | G -> A | LOC_Os07g01120.1 | upstream_gene_variant ; 4289.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700065801 | G -> A | LOC_Os07g01114.1 | downstream_gene_variant ; 864.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700065801 | G -> A | LOC_Os07g01110-LOC_Os07g01114 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0700065801 | NA | 8.64E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | NA | 9.27E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | NA | 9.96E-07 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | NA | 3.54E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | 6.40E-06 | 1.46E-07 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | NA | 7.99E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | NA | 5.68E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | NA | 8.68E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | 4.28E-06 | 4.28E-06 | mr1521 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | 7.11E-06 | 7.11E-06 | mr1939 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | 1.57E-06 | 1.57E-06 | mr1941 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700065801 | NA | 5.35E-07 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |