Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700013444:

Variant ID: vg0700013444 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 13444
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGTACTTCGGACTACCTCCATCCTAAAATATAGCTATTTCTAGCACAGTACTTTGTCCTAAAATGAAACTATTTTTCTACCTATCTTCTCCTCTCAAC[C/T]
AATCACAACTATTCTTTTTCACCTACTTTCTTTTTTCAATAAATCACACACCTTCTTCAATTATTCTCACCTACTTTCTTAATACCTATGCTAATCTTAA

Reverse complement sequence

TTAAGATTAGCATAGGTATTAAGAAAGTAGGTGAGAATAATTGAAGAAGGTGTGTGATTTATTGAAAAAAGAAAGTAGGTGAAAAAGAATAGTTGTGATT[G/A]
GTTGAGAGGAGAAGATAGGTAGAAAAATAGTTTCATTTTAGGACAAAGTACTGTGCTAGAAATAGCTATATTTTAGGATGGAGGTAGTCCGAAGTACTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 11.30% 17.54% 17.46% NA
All Indica  2759 22.70% 18.90% 29.25% 29.21% NA
All Japonica  1512 98.20% 0.30% 0.66% 0.79% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 3.50% 25.50% 41.18% 29.75% NA
Indica II  465 54.00% 5.20% 19.35% 21.51% NA
Indica III  913 20.00% 22.80% 25.08% 32.09% NA
Indica Intermediate  786 21.60% 17.40% 30.92% 30.03% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 95.40% 0.80% 1.59% 2.18% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 2.10% 3.12% 1.04% NA
Intermediate  90 76.70% 6.70% 10.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700013444 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700013444 C -> T LOC_Os07g01020.1 upstream_gene_variant ; 458.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700013444 C -> T LOC_Os07g01030.1 upstream_gene_variant ; 4071.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700013444 C -> T LOC_Os07g01020-LOC_Os07g01030 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0700013444 C T 0.04 0.04 0.04 0.04 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700013444 2.11E-10 NA mr1158 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 5.51E-10 5.99E-11 mr1158 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 6.38E-06 NA mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 NA 4.07E-07 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 NA 6.92E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 4.46E-07 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 1.98E-06 7.11E-09 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 NA 4.38E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 NA 5.18E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 NA 2.01E-12 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 8.20E-08 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 8.69E-08 3.51E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 8.21E-07 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 1.11E-07 4.01E-15 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 NA 6.73E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700013444 NA 1.21E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251