Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631078445:

Variant ID: vg0631078445 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 31078445
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

CGTATGTAATACTGTTGTTTGCTACTCATGAGTCAAGTTGGAGATAGCTTGATCTCGGAATATGGTTTCTTTGTTTGTTCTATGTGTAGGTGACTCGATG[C/T]
CTCGGGAGAGTATTTGCGGTGATGGACCAGGAGTCGACTTGGGGATAAGACGACGTCCGTGGTGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGA

Reverse complement sequence

TCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCACCACGGACGTCGTCTTATCCCCAAGTCGACTCCTGGTCCATCACCGCAAATACTCTCCCGAG[G/A]
CATCGAGTCACCTACACATAGAACAAACAAAGAAACCATATTCCGAGATCAAGCTATCTCCAACTTGACTCATGAGTAGCAAACAACAGTATTACATACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	4.20%	1.29%	0.00%	NA
All Indica	2759	90.80%	7.10%	2.03%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	92.30%	2.20%	5.55%	0.00%	NA
Indica II	465	88.40%	9.70%	1.94%	0.00%	NA
Indica III	913	88.40%	11.60%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	4.20%	1.78%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	1.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0631078445	C -> T	LOC_Os06g51320.1	upstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0631078445	C -> T	LOC_Os06g51320.2	upstream_gene_variant ; 4307.0bp to feature; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0631078445	C -> T	LOC_Os06g51320.3	upstream_gene_variant ; 4307.0bp to feature; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0631078445	C -> T	LOC_Os06g51310.1	downstream_gene_variant ; 964.0bp to feature; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0631078445	C -> T	LOC_Os06g51330.1	downstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0631078445	C -> T	LOC_Os06g51310.2	downstream_gene_variant ; 964.0bp to feature; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0631078445	C -> T	LOC_Os06g51330.2	downstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0631078445	C -> T	LOC_Os06g51310-LOC_Os06g51320	intergenic_region ; MODIFIER	silent_mutation	Average:46.464; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0631078445	NA	1.32E-11	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445	NA	4.50E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445	2.98E-06	2.60E-07	mr1019_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445	NA	1.76E-09	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445	7.57E-11	1.55E-16	mr1055_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445	8.48E-06	NA	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631078445	NA	3.45E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251