Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630943433:

Variant ID: vg0630943433 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30943433
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGGTTAAAGTTATAAAAGTTTGATATCAAACTCGTCCAAAATGTCGATTAATATCGAACCGGAGCGAGTACAGTATTAGTAGCAAGTCAGCCACATGG[G/T]
ACATGGCCCACATGCATGCACGTCGTATGAACACACCGTGATTCTTTGCCACTTGCATAATATTCTAGCACTGCTATACTACACGACGACTGACGGCGAC

Reverse complement sequence

GTCGCCGTCAGTCGTCGTGTAGTATAGCAGTGCTAGAATATTATGCAAGTGGCAAAGAATCACGGTGTGTTCATACGACGTGCATGCATGTGGGCCATGT[C/A]
CCATGTGGCTGACTTGCTACTAATACTGTACTCGCTCCGGTTCGATATTAATCGACATTTTGGACGAGTTTGATATCAAACTTTTATAACTTTAACCATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.00%	28.00%	0.00%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	17.10%	82.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	7.00%	93.00%	0.00%	0.00%	NA
Tropical Japonica	504	32.70%	67.30%	0.00%	0.00%	NA
Japonica Intermediate	241	16.60%	83.40%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630943433	G -> T	LOC_Os06g51150.1	upstream_gene_variant ; 763.0bp to feature; MODIFIER	silent_mutation	Average:96.736; most accessible tissue: Callus, score: 99.723	N	N	N	N
vg0630943433	G -> T	LOC_Os06g51150.2	upstream_gene_variant ; 763.0bp to feature; MODIFIER	silent_mutation	Average:96.736; most accessible tissue: Callus, score: 99.723	N	N	N	N
vg0630943433	G -> T	LOC_Os06g51140-LOC_Os06g51150	intergenic_region ; MODIFIER	silent_mutation	Average:96.736; most accessible tissue: Callus, score: 99.723	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0630943433	G	T	0.0	0.06	0.09	-0.03	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630943433	NA	8.55E-11	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	1.68E-56	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	7.21E-17	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	4.15E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	1.81E-06	1.80E-06	mr1232	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	9.77E-15	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	6.55E-38	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	9.70E-07	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	7.56E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	1.71E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	3.83E-32	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	3.15E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630943433	NA	7.94E-15	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251