Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630860627:

Variant ID: vg0630860627 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30860627
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATATAAGTTCAAATTTAAATTCTAGTTGTAATAAAAATAATAAATTTAATTGTGAATATATGTATACTAATTAAAGTTTGATTTGTTATTTTTTAGAA[C/T]
TTATAGAAGTCGAATTTAAACTTGCATGTTTGTGATATGACATATTAAATATGAAATTTAACTTGTTAATTTTTTGATTTTTTTATAATCATTTAGTTGA

Reverse complement sequence

TCAACTAAATGATTATAAAAAAATCAAAAAATTAACAAGTTAAATTTCATATTTAATATGTCATATCACAAACATGCAAGTTTAAATTCGACTTCTATAA[G/A]
TTCTAAAAAATAACAAATCAAACTTTAATTAGTATACATATATTCACAATTAAATTTATTATTTTTATTACAACTAGAATTTAAATTTGAACTTATATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	11.50%	1.14%	3.79%	NA
All Indica	2759	98.00%	1.90%	0.04%	0.04%	NA
All Japonica	1512	67.30%	19.50%	1.72%	11.44%	NA
Aus	269	50.60%	48.70%	0.37%	0.37%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	96.30%	3.60%	0.11%	0.00%	NA
Indica Intermediate	786	97.70%	2.20%	0.00%	0.13%	NA
Temperate Japonica	767	83.70%	1.20%	0.65%	14.47%	NA
Tropical Japonica	504	43.70%	52.60%	1.79%	1.98%	NA
Japonica Intermediate	241	64.70%	8.70%	4.98%	21.58%	NA
VI/Aromatic	96	15.60%	55.20%	26.04%	3.12%	NA
Intermediate	90	84.40%	13.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630860627	C -> T	LOC_Os06g50980.1	downstream_gene_variant ; 4506.0bp to feature; MODIFIER	silent_mutation	Average:20.401; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0630860627	C -> T	LOC_Os06g50990.1	downstream_gene_variant ; 1164.0bp to feature; MODIFIER	silent_mutation	Average:20.401; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0630860627	C -> T	LOC_Os06g50990-LOC_Os06g51000	intergenic_region ; MODIFIER	silent_mutation	Average:20.401; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0630860627	C -> DEL	N	N	silent_mutation	Average:20.401; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630860627	NA	1.30E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630860627	9.34E-06	NA	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630860627	NA	5.04E-08	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630860627	8.77E-08	NA	mr1836_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251