Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630856304:

Variant ID: vg0630856304 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30856304
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAGTCAAGTGCAAAGTGCTGTAAATATTCCAAAGTTTTTGTGCAGCTACGTAGTACATGGAAATGTGCTTCATCGCTGTGTATTGCACCTGCATTCTG[A/G]
CACATGTACTGTTTTTGCCCTGTAAAAATGTGTGCGTTTTTACTCAGAATTTTCCACGACAGCTCATGCCGGCTAATTATAGCTCAGTAAGTTGTTGAGA

Reverse complement sequence

TCTCAACAACTTACTGAGCTATAATTAGCCGGCATGAGCTGTCGTGGAAAATTCTGAGTAAAAACGCACACATTTTTACAGGGCAAAAACAGTACATGTG[T/C]
CAGAATGCAGGTGCAATACACAGCGATGAAGCACATTTCCATGTACTACGTAGCTGCACAAAAACTTTGGAATATTTACAGCACTTTGCACTTGACTACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	27.30%	0.11%	0.00%	NA
All Indica	2759	85.70%	14.10%	0.18%	0.00%	NA
All Japonica	1512	42.00%	58.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.10%	7.70%	0.17%	0.00%	NA
Indica II	465	87.50%	12.50%	0.00%	0.00%	NA
Indica III	913	78.50%	21.20%	0.22%	0.00%	NA
Indica Intermediate	786	88.20%	11.60%	0.25%	0.00%	NA
Temperate Japonica	767	22.40%	77.60%	0.00%	0.00%	NA
Tropical Japonica	504	70.80%	29.20%	0.00%	0.00%	NA
Japonica Intermediate	241	44.00%	56.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630856304	A -> G	LOC_Os06g50990.1	upstream_gene_variant ; 1304.0bp to feature; MODIFIER	silent_mutation	Average:51.418; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0630856304	A -> G	LOC_Os06g50980.1	downstream_gene_variant ; 183.0bp to feature; MODIFIER	silent_mutation	Average:51.418; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0630856304	A -> G	LOC_Os06g50980-LOC_Os06g50990	intergenic_region ; MODIFIER	silent_mutation	Average:51.418; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630856304	NA	5.38E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	1.68E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	8.17E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	1.69E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	8.37E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	5.85E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	1.60E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	8.28E-07	mr1892	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	3.20E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630856304	NA	1.20E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251