Search for Variation information by Variation ID:
Detailed information for vg0630441488:
| Variant ID: vg0630441488 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30441488 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.00, others allele: 0.00, population size: 245. )
Flanking Sequence (100 bp) in Reference Genome:
CCTAAATTCTGTAATTGGGACCTAGTACTTTTGCAGGTCTTGGAGAAGATTGCTTGCTATGTTACTGTAAGGGGTGAGAAGGCAATGCAGCTTCTGGAGA[T/G]
TGGACTGAAGGTCAAAGAATATGAACTAGTCTCTGTTTTGCTATGTTTTGGAATCCAGGAGCACATCAATTGCTAATTGGAAGTAGTCTCTGTTTTGCTA
Reverse complement sequence
TAGCAAAACAGAGACTACTTCCAATTAGCAATTGATGTGCTCCTGGATTCCAAAACATAGCAAAACAGAGACTAGTTCATATTCTTTGACCTTCAGTCCA[A/C]
TCTCCAGAAGCTGCATTGCCTTCTCACCCCTTACAGTAACATAGCAAGCAATCTTCTCCAAGACCTGCAAAAGTACTAGGTCCCAATTACAGAATTTAGG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 36.60% | 2.31% | 11.53% | NA |
| All Indica | 2759 | 70.10% | 18.20% | 2.46% | 9.24% | NA |
| All Japonica | 1512 | 20.60% | 62.60% | 1.26% | 15.54% | NA |
| Aus | 269 | 13.00% | 82.20% | 4.09% | 0.74% | NA |
| Indica I | 595 | 43.90% | 42.70% | 4.20% | 9.24% | NA |
| Indica II | 465 | 78.10% | 4.10% | 1.94% | 15.91% | NA |
| Indica III | 913 | 82.30% | 10.20% | 1.42% | 6.13% | NA |
| Indica Intermediate | 786 | 71.20% | 17.20% | 2.67% | 8.91% | NA |
| Temperate Japonica | 767 | 1.60% | 94.00% | 0.00% | 4.43% | NA |
| Tropical Japonica | 504 | 47.00% | 16.50% | 3.37% | 33.13% | NA |
| Japonica Intermediate | 241 | 26.10% | 58.90% | 0.83% | 14.11% | NA |
| VI/Aromatic | 96 | 17.70% | 34.40% | 6.25% | 41.67% | NA |
| Intermediate | 90 | 46.70% | 33.30% | 5.56% | 14.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630441488 | T -> G | LOC_Os06g50290.1 | missense_variant ; p.Ile422Ser; MODERATE | nonsynonymous_codon ; I422S | Average:11.171; most accessible tissue: Callus, score: 39.059 | possibly damaging  |
-1.873 |
TOLERATED | 0.20 |
| vg0630441488 | T -> DEL | LOC_Os06g50290.1 | N | frameshift_variant | Average:11.171; most accessible tissue: Callus, score: 39.059 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630441488 | NA | 6.35E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630441488 | 1.41E-06 | 1.80E-08 | mr1411 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630441488 | NA | 1.82E-07 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630441488 | NA | 4.58E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630441488 | 8.90E-06 | 8.90E-06 | mr1286_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630441488 | 1.71E-06 | 1.71E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630441488 | NA | 2.89E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630441488 | NA | 2.06E-06 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |