Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629926258:

Variant ID: vg0629926258 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 29926258
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

GTCACTATCGGCTTCAGAGTCTTGGAATCGGCCGATGGGAGTTGTCAAGTCGCCAGCAATTGTGTTCTATATGAAGTCGGATCAATTAAAGAAAATTTAT[C/T]
CAAAAGAGTCCGAGTTCAAGGAGGATGCGGCATGACAAGTATATCTATTAATTAAGAATAGTATGTTAGTTTTCTTTTATCTCTAGAAAAGTGTGTTTAT

Reverse complement sequence

ATAAACACACTTTTCTAGAGATAAAAGAAAACTAACATACTATTCTTAATTAATAGATATACTTGTCATGCCGCATCCTCCTTGAACTCGGACTCTTTTG[G/A]
ATAAATTTTCTTTAATTGATCCGACTTCATATAGAACACAATTGCTGGCGACTTGACAACTCCCATCGGCCGATTCCAAGACTCTGAAGCCGATAGTGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.00%	16.50%	1.33%	55.12%	NA
All Indica	2759	17.90%	0.50%	0.62%	80.94%	NA
All Japonica	1512	43.80%	49.90%	2.38%	3.90%	NA
Aus	269	1.10%	1.50%	1.86%	95.54%	NA
Indica I	595	11.80%	0.70%	0.17%	87.39%	NA
Indica II	465	35.50%	0.20%	0.65%	63.66%	NA
Indica III	913	11.00%	0.20%	0.33%	88.50%	NA
Indica Intermediate	786	20.40%	0.90%	1.27%	77.48%	NA
Temperate Japonica	767	4.30%	90.00%	2.09%	3.65%	NA
Tropical Japonica	504	93.30%	1.60%	0.60%	4.56%	NA
Japonica Intermediate	241	66.40%	23.20%	7.05%	3.32%	NA
VI/Aromatic	96	86.50%	0.00%	1.04%	12.50%	NA
Intermediate	90	35.60%	11.10%	4.44%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0629926258	C -> T	LOC_Os06g49380.1	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> T	LOC_Os06g49380.2	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> T	LOC_Os06g49380.3	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> T	LOC_Os06g49380.4	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> T	LOC_Os06g49380.5	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> T	LOC_Os06g49380.6	upstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> T	LOC_Os06g49390.1	downstream_gene_variant ; 512.0bp to feature; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> T	LOC_Os06g49380-LOC_Os06g49390	intergenic_region ; MODIFIER	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N
vg0629926258	C -> DEL	N	N	silent_mutation	Average:10.513; most accessible tissue: Callus, score: 60.944	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0629926258	NA	5.16E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	4.12E-37	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	5.88E-21	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	5.39E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	5.97E-16	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	8.49E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	5.02E-31	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	2.50E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	9.70E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	1.38E-07	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	1.27E-20	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	5.52E-41	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	1.80E-06	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	6.31E-23	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	1.01E-07	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	8.75E-13	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629926258	NA	5.80E-22	mr1980_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251