Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629645562:

Variant ID: vg0629645562 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 29645562
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGACTTGTCTTTTTAATTTTTTTCATATTTTTTTCAAATAAGACGGACGGTCAAACGTTGGACACGGAAACCAGGCTTTGTCTTTTTTTTTTATGACGG[T/A]
GGGAGTACATTCACTCTTCACTGAATCATCAGACGGTCGATGCACCTTTGCCCGCGGCGAGATCAACGGATCTTGGCCGTCCGATATGTCCTTTGTGTTT

Reverse complement sequence

AAACACAAAGGACATATCGGACGGCCAAGATCCGTTGATCTCGCCGCGGGCAAAGGTGCATCGACCGTCTGATGATTCAGTGAAGAGTGAATGTACTCCC[A/T]
CCGTCATAAAAAAAAAAGACAAAGCCTGGTTTCCGTGTCCAACGTTTGACCGTCCGTCTTATTTGAAAAAAATATGAAAAAAATTAAAAAGACAAGTCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	21.50%	2.12%	3.36%	NA
All Indica	2759	89.50%	1.60%	3.33%	5.58%	NA
All Japonica	1512	37.00%	62.80%	0.13%	0.07%	NA
Aus	269	96.70%	1.50%	1.49%	0.37%	NA
Indica I	595	93.60%	1.20%	4.37%	0.84%	NA
Indica II	465	88.00%	1.10%	3.87%	7.10%	NA
Indica III	913	91.70%	0.30%	1.31%	6.68%	NA
Indica Intermediate	786	84.90%	3.60%	4.58%	7.00%	NA
Temperate Japonica	767	19.30%	80.40%	0.26%	0.00%	NA
Tropical Japonica	504	61.90%	38.10%	0.00%	0.00%	NA
Japonica Intermediate	241	41.50%	58.10%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	75.60%	18.90%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0629645562	T -> A	LOC_Os06g48940-LOC_Os06g48950	intergenic_region ; MODIFIER	silent_mutation	Average:72.168; most accessible tissue: Callus, score: 97.761	N	N	N	N
vg0629645562	T -> DEL	N	N	silent_mutation	Average:72.168; most accessible tissue: Callus, score: 97.761	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0629645562	T	A	0.0	0.02	0.01	-0.04	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0629645562	NA	1.51E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	NA	2.02E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	NA	2.79E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	NA	6.93E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	NA	3.63E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	7.68E-06	1.90E-09	mr1622	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	NA	1.23E-09	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	NA	1.15E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629645562	NA	5.27E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251