Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629378360:

Variant ID: vg0629378360 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 29378360
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, T: 0.50, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCGGGCCAGGGTTACCGCACCCCAGTGGTAAGCACGGTTACCACGCGGTAACCGTGGCAAGCCGTACCAAACCATATAAAATTTATAACAAGTAGAGA[T/C]
GGCGGCCACGGGCGTAGGGCGGAGGCCAAGGACGGACCTAGAGTATACTCAATGGGGGGCCTTGGCCCCTACTCAATTCTAGATAGCACGGGGGGCAAAT

Reverse complement sequence

ATTTGCCCCCCGTGCTATCTAGAATTGAGTAGGGGCCAAGGCCCCCCATTGAGTATACTCTAGGTCCGTCCTTGGCCTCCGCCCTACGCCCGTGGCCGCC[A/G]
TCTCTACTTGTTATAAATTTTATATGGTTTGGTACGGCTTGCCACGGTTACCGCGTGGTAACCGTGCTTACCACTGGGGTGCGGTAACCCTGGCCCGACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 37.90% 0.15% 0.00% NA
All Indica  2759 54.50% 45.30% 0.18% 0.00% NA
All Japonica  1512 82.90% 17.10% 0.00% 0.00% NA
Aus  269 42.80% 57.20% 0.00% 0.00% NA
Indica I  595 20.70% 79.00% 0.34% 0.00% NA
Indica II  465 66.00% 34.00% 0.00% 0.00% NA
Indica III  913 71.50% 28.40% 0.11% 0.00% NA
Indica Intermediate  786 53.60% 46.20% 0.25% 0.00% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 72.40% 27.60% 0.00% 0.00% NA
Japonica Intermediate  241 62.20% 37.80% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0629378360 T -> C LOC_Os06g48560.1 upstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:70.456; most accessible tissue: Zhenshan97 flower, score: 92.109 N N N N
vg0629378360 T -> C LOC_Os06g48540.1 downstream_gene_variant ; 2138.0bp to feature; MODIFIER silent_mutation Average:70.456; most accessible tissue: Zhenshan97 flower, score: 92.109 N N N N
vg0629378360 T -> C LOC_Os06g48570.1 downstream_gene_variant ; 4877.0bp to feature; MODIFIER silent_mutation Average:70.456; most accessible tissue: Zhenshan97 flower, score: 92.109 N N N N
vg0629378360 T -> C LOC_Os06g48550.1 intron_variant ; MODIFIER silent_mutation Average:70.456; most accessible tissue: Zhenshan97 flower, score: 92.109 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0629378360 T C 0.0 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0629378360 3.89E-07 3.89E-07 mr1358 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629378360 NA 9.49E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629378360 NA 5.43E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629378360 NA 9.70E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251