Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628759426:

Variant ID: vg0628759426 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 28759426
Reference Allele: TA	Alternative Allele: GA,T
Primary Allele: TA	Secondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGGAGACCGCCGCCATGATGGCCCGATGAGAACTAGAGGACAGCCAGCTTATAAACACCTAGCGAGCTGAATTCCAATATATCTATAAGTATGTTTTTT[TA/GA,T]
GATAATAAAATATAATATCCTGGCCTTTGCTCAAATATCTTATAAGTATGTAACTGTTCCAATTGTAATTATACTGAAAATCATTCGTGTGGGTAAGAAT

Reverse complement sequence

ATTCTTACCCACACGAATGATTTTCAGTATAATTACAATTGGAACAGTTACATACTTATAAGATATTTGAGCAAAGGCCAGGATATTATATTTTATTATC[TA/TC,A]
AAAAAACATACTTATAGATATATTGGAATTCAGCTCGCTAGGTGTTTATAAGCTGGCTGTCCTCTAGTTCTCATCGGGCCATCATGGCGGCGGTCTCCCG

Allele Frequencies:

Populations	Population Size	Frequency of TA(primary allele)	Frequency of GA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.70%	1.70%	0.49%	0.08%	T: 0.02%
All Indica	2759	99.70%	0.00%	0.11%	0.14%	NA
All Japonica	1512	93.60%	5.10%	1.32%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.00%	T: 0.37%
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.10%	0.13%	0.38%	NA
Temperate Japonica	767	92.80%	5.10%	2.09%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	86.30%	12.00%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628759426	TA -> T	LOC_Os06g47470.1	upstream_gene_variant ; 2017.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> T	LOC_Os06g47490.1	upstream_gene_variant ; 522.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> T	LOC_Os06g47480.1	downstream_gene_variant ; 52.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> T	LOC_Os06g47500.1	downstream_gene_variant ; 2933.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> T	LOC_Os06g47510.1	downstream_gene_variant ; 3627.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> T	LOC_Os06g47480-LOC_Os06g47490	intergenic_region ; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> DEL	N	N	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> GA	LOC_Os06g47470.1	upstream_gene_variant ; 2016.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> GA	LOC_Os06g47490.1	upstream_gene_variant ; 523.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> GA	LOC_Os06g47480.1	downstream_gene_variant ; 51.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> GA	LOC_Os06g47500.1	downstream_gene_variant ; 2934.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> GA	LOC_Os06g47510.1	downstream_gene_variant ; 3628.0bp to feature; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N
vg0628759426	TA -> GA	LOC_Os06g47480-LOC_Os06g47490	intergenic_region ; MODIFIER	silent_mutation	Average:80.795; most accessible tissue: Minghui63 root, score: 93.758	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0628759426	TA	GA	-0.01	-0.01	-0.01	-0.01	-0.01	-0.01
vg0628759426	TA	T	-0.03	0.0	0.02	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628759426	4.33E-08	4.33E-08	mr1098	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	2.84E-06	2.84E-06	mr1099	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	2.60E-08	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	8.10E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	1.43E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	2.96E-09	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	5.47E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	1.55E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	2.17E-07	1.74E-10	mr1123	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	2.42E-06	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	6.55E-06	3.99E-07	mr1239	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	4.89E-07	2.00E-09	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	7.98E-09	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	1.66E-07	1.36E-09	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	5.46E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	1.98E-06	2.87E-10	mr1495	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	1.83E-07	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	4.11E-06	4.11E-06	mr1589	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	9.98E-08	3.35E-10	mr1858	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	9.98E-08	3.35E-10	mr1859	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	3.19E-06	3.19E-06	mr1868	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	1.86E-07	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	1.45E-07	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	3.65E-06	1.02E-07	mr1098_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	9.57E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	5.98E-07	1.09E-08	mr1114_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	8.43E-07	1.69E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	1.50E-06	7.92E-10	mr1118_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	8.05E-06	1.17E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	2.63E-06	3.39E-08	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	1.59E-06	3.27E-09	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	6.97E-07	3.20E-09	mr1150_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	2.48E-08	6.68E-11	mr1240_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	2.24E-06	1.38E-08	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	4.61E-06	4.61E-06	mr1244_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	NA	2.71E-07	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	1.75E-06	4.68E-09	mr1495_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	1.74E-06	1.65E-08	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628759426	4.73E-06	4.16E-08	mr1936_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251